1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AfilCa [17]
1 year ago
12

Explain why meiosis can be called cell reduction.

Biology
1 answer:
Makovka662 [10]1 year ago
4 0
The answer is because it lowers the number of chromosomes in half, ensuring that the fusion will have the appropriate amount of chromosomes after the fusing of the sperm and the egg.
You might be interested in
Briefly discuss the current controversy about which complex organic molecules formed first: nucleic acids or proteins
Romashka-Z-Leto [24]

The controversy surrounding the nucleic acids and proteins, regarding which one of them was formed first is the most popular controversy in the biology world today. The nucleic acids stores and the genetic information. The proteins essential for all the life processes are encoded by the genes formed of the nucleic acids (DNA and RNA). But proteins (enzymes) are required for the formation of proteins from the genes. The inter-dependency of the nucleic acids and proteins on each other possesses a dilemma to the question 'which of them arrived first'.

The answer to this dilemma was answered when it was discovered that RNA was capable of not only carrying the genetic information, but also acting as catalyst to the chemical reaction. This finding supported the notion that the RNA evolved first serving the purpose of both the nucleic acids and emzymes.

6 0
3 years ago
Can you give me 5 chordates? preferably ones that live in oregon hhhh
Karolina [17]
I cant help you with that
3 0
3 years ago
Theophrastus was considered the "Father of Botany" in the approximate year _____.
Anvisha [2.4K]
<span>300BC was the approximate year.

</span>
7 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Someone please help me with this Punnett square!! Rryy x rrYy
borishaifa [10]
Maybe this helps ? Please look at the picture

6 0
3 years ago
Other questions:
  • All organisms need instructions to specify their traits. The instructions, or code, that is responsible for all the inherited tr
    14·2 answers
  • PLANTS: REPRODUCTION and RESPONSE
    6·1 answer
  • What are the different functions of the skin? select all that apply?
    10·1 answer
  • find some more information about wildlife and countryside abuse share it with your friends. you may begin with "Do you know that
    8·1 answer
  • Standard measures devised to assess behavior objectively; used by psychologists to help people make decisions about their lives
    15·1 answer
  • Which product of photosynthesis contains the chemical energy that was made from the radiant energy
    5·1 answer
  • Based on what you know about energy, what type of energy does light best represent?
    8·1 answer
  • Simplify the combined equation for photosynthesis by crossing out compounds that are both products and reactants. How does this
    8·1 answer
  • A specific type of bacteria reproduces through binary fission every two hours. If there are seven bacteria to begin with, how ma
    13·2 answers
  • Question:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!