1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VladimirAG [237]
1 year ago
12

the size difference between most multicellular hosts and their pathogens results in which of the following evolutionary advantag

es for the pathogen? group of answer choices pathogens have larger population sizes and shorter generation times than hosts, allowing for increased rates of adaptation. pathogens have lower mutation rates than hosts, resulting in more stable populations. hosts evolve more rapidly due to mutations induced by the pathogen. host population sizes increase in the presence of a pathogen, providing more potential hosts for infection.
Biology
1 answer:
professor190 [17]1 year ago
6 0

Pathogens can adapt more quickly than hosts since they have higher populations and faster generation periods.

Pathogens, of course, have the advantage in this evolutionary game because they can change far more quickly than the hosts—especially in long-lived animals like humans—due to their high population numbers and rapid generation rates. The relationship between surface area and complement activation shows how bacterial pathogenicity may be influenced by tiny size. The region of the microbial surface may also have a role in their action since other antimicrobial agents are focused there. A pathogen reacts with the host and creates infection, which results in the host being ill. Any dangerous microbial agent, including bacteria, viruses, protozoa, fungi, and helminths, might be considered a pathogen.

Learn more about pathogen

brainly.com/question/13051879

#SPJ4

You might be interested in
Ardipithecus ramidus had a small, chimpanzee-like body that was adapted to which condition?
erma4kov [3.2K]

Answer: the trees

Explanation:

8 0
3 years ago
What species is commonly farmed in man made coastal ponds?
Yanka [14]

Answer: Freshwater aquaculture produces species such as catfish and trout. Freshwater aquaculture primarily takes place in ponds or other manmade systems.

Explanation:

6 0
3 years ago
What does photosynthesis produce (make) ?
Elan Coil [88]

Answer:

photosynthesis produce food for plants

8 0
2 years ago
To which organelle does a C-terminal signal peptide sequence of the four amino acids KDELdirect peptides?
Fofino [41]

Answer:

Endoplasmic reticulum.

Explanation:

Protein synthesis, sorting and transport is the important mechanism for the synthesis of protein in the body and the transport of the protein to its specific site or organ. The protein must reaches to its final destination for its proper functioning.

KDEL ( K- leucine, D is aspartic acid, E is glutamic acid and L is lysine ) is the stretch of a specific amino acid that are responsible for the protein molecule to target at its specific site. KDEL is specific for the transport of peptides to the endoplasmic reticulum.

Thus, the correct answer is option (A).

7 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • What is the ultimate base level of a stream
    6·2 answers
  • WILL REWARD :)
    10·1 answer
  • A wind turbine generating electricity involves electromagnetic energy. thermal energy. solar energy. mechanical energy. chemical
    8·1 answer
  • The specification of the anterior-posterior axis in Drosophila embryos is initially controlled by various gene products that are
    6·1 answer
  • What is photorespiration? Why is it bad and why does it occur?
    9·1 answer
  • The trait for sickle cell anemia in humans shows a recessive pattern of inheritance. The alleles for sickle cell anemia in two i
    7·2 answers
  • Fungi and bacteria are considered
    14·1 answer
  • What is Blumenbach's 1775 Classification
    7·1 answer
  • Which statement describes the ability of the cell membrane to allow various substance to move through it?
    14·1 answer
  • The ________ duct empties into the vestibule at the level of the second upper molar. parotid vestibular submaxillary sublingual
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!