Facilitates the roots of plants going down towards gravity and the stems to rise up away from gravity. ... Thus, the difference is that geotropism is driven by gravity and phototropism is driven by light.
Answer:
I don't know sorry need kalng points HAHAHAHAHAHA
This organ is the pancreas. It is a very small endocrine gland measuring 6 inches that is located on the left abdomen near the duodenum of the small intestine and the spleen. The pancreas is a very important organ that secretes digestive enzymes like:
pancreatic amylase - breaks down polysaccarides and glycogen into simple sugars
trypsin- breaks down proteins into amino acids
pancreatic lipase - breaks down triglycerides to fatty acids and monoglycerides
ribonuclease - digests nucleic acids
It also secretes insulin and glucagon to regulate blood sugar levels.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
