1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
9 months ago
12

You have two carts, one which is empty and has mass m. The second cart is of the same mass but

Biology
1 answer:
Ahat [919]9 months ago
7 0

Their kinetic energies would be the same. The cart is empty and has a mass m. The second cart is of the same mass but loaded with twice the mass of the empty cart. 1 joule of work or energy is equal to the work done by a force of one newton acting through one meter.

<h3>What is kinetic energy? </h3>

A moving item or particle might have the power of a certain sort called kinetic energy. When work, which entails the transfer of energy, is done on an object by applying a net force, that object acquires kinetic energy. Kinetic energy, which depends on an item or particle's mass and velocity of motion, is a property of motion. Any combination of vibration, axis rotation, translation (or movement along a route from one place to another), and translation are all examples of motion.

The kinetic energy of each would be equal.

This is because the force, F, acting on them moves the same distance, d, hence the work done by the force is W = Fd.

Using the ideas of work-kinetic energy, let's now

W = K, where K is the difference in the kinetic energy of the carts.

Given that the effort done was the same for both carts, the change in kinetic energy would also be equal.

Since they start at rest, K = K' - K = K' - 0 = K'.

Therefore, the kinetic energies of the carts would be the same.

Read more about kinetic energy, here

brainly.com/question/12669551

#SPJ1

You might be interested in
Provide a specific example of photosynthesis and cellular respiration working together.
pshichka [43]
Photosynthesis makes glucose that is used in cellular respiration I think that’s how they work together
7 0
2 years ago
98 POINTS 98 POINTS<br><br> PLS HELP MEEEE
blsea [12.9K]
I know them in Spanish 
Esta formado por los 206 huesos repartidos por casi todas las partes del cuerpo.  Que permiten el aparato locomotor  Que pueden ser largos, cortos, planos  Que forman el esqueleto y proteccion para los organos internos  Que se unen en tejido oseo, y tejido cartilaginoso  Que son la columna vertebral, craneo, y pelvis
7 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Can anybody help me? Anything will help thank you(,:
erma4kov [3.2K]

Answer:

1. 4 generations

2. the father/male parent carries the recessive allele (individual 2 of the 1st generation)

3. individual 1 has a hom.ozygous spouse.

4. Generation 3

Explanation:

sorry if any of these are wrong

(also i had to put a period there so it wouldnt identify hom.ozygous as a slur)

5 0
2 years ago
During fertilization gametes join to form a diploid cell known as a ________
oksian1 [2.3K]

Answer:

zygotes

Explanation:

Human fertilization and development

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

5 0
2 years ago
Other questions:
  • This is a plastid with chlorophyll in plants that photosynthesize.
    13·2 answers
  • What is the starting point of all food chains/webs?
    14·2 answers
  • Why is biomass a better alternative to coal?
    9·2 answers
  • What is the structure on a flowering plant that receives the pollen granules?
    15·1 answer
  • Which statement about relative potential energy of electrons is correct?
    8·2 answers
  • When hydrogen ions are decreased, is the pH higher or<br>lower?<br>wi<br>and for​
    7·1 answer
  • A purebred purple flowering plant is crossed with a purebred white flowering plant, and they produce offspring that have purple
    8·2 answers
  • Which describes one thing that happens during thermoregulation when a sensor
    9·1 answer
  • The atmosphere interacts with the hydrosphere in the blank
    15·1 answer
  • Punnett squares use mathematical probability to help predict the genotype and phenotype combinations in genetic crosses. Select
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!