1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
murzikaleks [220]
3 years ago
13

Which statement about the cell membrane is true

Biology
1 answer:
Ainat [17]3 years ago
6 0

that is has a nucleus and also a cell wall

You might be interested in
Chromosomes are found in the (i)__________ of every living cell. They can be seen by (ii)__________ a cell that is about to (iii
rusak2 [61]

Answer:

Explanation:

i) nucleus

ii) mitosis

iii) split

iv) pairs

v) number

vi) 46

vii) 23

viii) 7

ix) 127

x) arm

7 0
2 years ago
What Evidence supports natural selection
SashulF [63]
<span>Fossil record, genetics, and examples of local adaptations all support the theory of evolution by natural selection.</span>
3 0
3 years ago
Read 2 more answers
What is and exoskeleton and explain in full clear sentences please
LekaFEV [45]

An exoskeleton is the outer skeleton of an animal to protect them. An exoskelton is also called a shell.

7 0
3 years ago
What are 2 characteristics of Eukaryotes?
AnnyKZ [126]

Answer:

prokaryotic cells, eukaryotic cells have: a membrane-bound nucleus. numerous membrane-bound organelles (including the endoplasmic reticulum, Golgi apparatus, chloroplasts, and mitochondria) several rod-shaped chromosomes

Explanation:

4 0
3 years ago
Read 2 more answers
I need help with 1-12
Reil [10]
Your doing biology ?
3 0
4 years ago
Other questions:
  • What element is found it all organic molecules
    13·1 answer
  • During ____, the newly developed squamous epithelial cells of the cervix are vulnerable to development of ____ and _____ changes
    6·1 answer
  • Which of these muscles produces lateral rotation at the hip?
    5·1 answer
  • Hypothesize what might happen if the deletion mutation was at the end of the gene rather than towards the beginning
    8·1 answer
  • ______ is conserved when metamorphic rock melts and turns into lava.
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which statement is true about the solar system? A) Inner planets have more moons than outer planets have. B) Inner planets are g
    12·2 answers
  • If enzymes are made up of proteins, then can proteins be considered as monomers to enzymes?
    10·1 answer
  • I’m not sure which ones it is
    9·1 answer
  • If all of the trees in the area were cut down, the energy supply of which population would be most directly affected
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!