AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
We fear flying in a plane, nuclear power plants or being struck by lightning more because our risk perception isn't rational. We assess risks using a mixture of cognitive skills (weighing the evidence, using reasoning and logic to reach conclusions) and emotional appraisals. In this case, we believe that overheating or lack of exercise is something we can control. We believe we can feel the process taking place and we can react in time. We fear all the situations that we cannot control.
Explanation:
All cells share four common components: (1) a plasma membrane, an outer covering that separates the cell’s interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell; and (4) ribosomes, particles that synthesize proteins. However, prokaryotes differ from eukaryotic cells in several ways.
C is what i think is correct.
