1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svlad2 [7]
3 years ago
10

Because of the large heat of __________ of water, the evaporation from a liquid surface is a very effective cooling mechanism. T

he human body makes use of evaporative cooling by __________ to give off energy even when surrounded by a temperature higher than body temperature. A) fusion; transpiration B) vaporization; shivering C) sublimation; perspiration D) vaporization; perspiration
Biology
2 answers:
jeyben [28]3 years ago
7 0
D) Vaporization; Perspiration
 Perspiration is when the human body kinda evaporates the sweat to cool the body down
KIM [24]3 years ago
3 0

vaporization; perspiration. Water has a high specific heat capacity due to its polarity. It therefore also has a high heat of vaporization: the energy required to turn liquid water (sweat) into a gas.

You might be interested in
Please help me with this task, it should be mini essay with own words
Verizon [17]
Acids have a ph of 6 and below whole bases have a ph of 8 and above. If a human has to much acid in their stomach they can take a pill that will lower it back to its normal ph level
8 0
3 years ago
Read 2 more answers
URGENT!! WHATS THE ATOM IN WHITE?!!?
garri49 [273]

Answer:

hydrogen

Explanation:

5 0
2 years ago
Read 2 more answers
After experimenting with the injection of various solutions into specific areas of a rat's brain and observing the subsequent ba
Maurinko [17]
<span>The types of effects that the surgery had on the rats were documented with their bar-pressing behavior. The differences and changes from the injections effected the rats in certain ways. The location of the injection and which types that was more pleasurable for the rat is something that needs further investigation.</span>
8 0
3 years ago
Transcribe GTCATA into an mRNA strand.
DiKsa [7]

Answer:

The answer is CAGUAU

5 0
3 years ago
Type the correct answer in the box. Spell all words correctly. What is the correct term for blocked sunlight and reduced solar r
vagabundo [1.1K]
A volcanic winter is a reduction in global temperatures caused by volcanic ash and droplets of sulfuric acid and water obscuring the Sun and raising Earth's albedo (increasing the reflection of solar radiation) after a large, particularly explosive volcanic eruption.
8 0
3 years ago
Read 2 more answers
Other questions:
  • In the chain, which data show a possible source of error Tyr-Leu-Pro-Met
    11·2 answers
  • Becky wanted to figure out what type of liquid worked best for growing beans. She watered
    14·1 answer
  • How does human evolution or natural selection relate to the susceptibility of disease
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Where does the energy to change the shoreline come from?
    11·1 answer
  • A 16 N net force acts on a 4 kg rock. What is the acceleration of the rock? *
    8·2 answers
  • Why do airplane pilots like to fly in the stratosphere?
    15·1 answer
  • Why is our perception faulty?
    10·2 answers
  • What if plants AND humans needed photosynthesis to live?
    10·2 answers
  • What is ecology and the functions​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!