1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GuDViN [60]
3 years ago
8

Chemical weathering would be most effective ________. in a warm, humid climate equally in any kind of climate in a cold, dry cli

mate in a warm, dry climate
Biology
2 answers:
Dmitrij [34]3 years ago
3 0
I think the correct answer would be the first option. Chemical weathering would be most effective in a warm, humid climate. It is a type of erosion which is caused by chemical reaction that happens naturally in the environment. It is usually caused from the reaction of the minerals found in rocks with the rain water. These reactions happen when the rain water contains acidic components. Also, its occurrence would be more fast in places where there is high temperature or in warm regions specifically for hydrolysis and oxidation reactions. For the reactions to happen, the presence of water is very important so it most likely in humid places.
poizon [28]3 years ago
3 0

Answer:

Most effective in a warm, humid climate

You might be interested in
decide if each statement is a fact or misconception about the theory of evolution by natural selection
Alborosie
Was there supposed to be an image?
8 0
3 years ago
Describe the circle of life as it applies to the biogeochemical cycle of the lion king video questions
NISA [10]
It shows that a lion cub can be king one day

5 0
3 years ago
How does the liver help in maintaining homeostasis
irga5000 [103]

Answer:

The liver plays a major role in blood glucose homeostasis by maintaining a balance between the uptake and storage of glucose via glycogenolysis and gluconeogenesis. The liver is the primary organ for glucose metabolism.

Glycogenolysis: Glycogenolysis is the biochemical pathway in which glycogen breaks down into glucose-1-phosphate and glycogen.  

Gluconeogenesis: Gluconeogenesis is the synthesis of glucose from non-sugar precursors, such as lactate, pyruvate, and the carbon skeleton of glucogenic amino acids.

5 0
3 years ago
PLEASE HELP Compounds that always contain the element carbon are called
kvv77 [185]
I believe the answer is organic compound
3 0
3 years ago
Which of the following has a negitive impact on biodiversity
andreyandreev [35.5K]
Where are the options?
5 0
3 years ago
Other questions:
  • If two inedible insects share common colors, they may be warning a predator. This type of defense is called _____. Müllerian mim
    10·1 answer
  • ****PLEASE RESPOND ASAP! I WILL GIVE BRAINLIEST!****
    10·2 answers
  • What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGA
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What are viral hémorragie fevers (VHFs) ?
    13·1 answer
  • What are potential problems with chemical pesticides? check all that apply
    10·1 answer
  • The endocrine system includes specialized cells that help fight bacteria and viruses
    5·2 answers
  • What's another term for "Healthy Carrier"
    13·1 answer
  • What type of transport occurred in the lab with the egg placed in water
    9·1 answer
  • How can multiple pollinators share the same habitat if they all need pollen?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!