The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
B Carbón dioxide
Not sure
Eso puede surgir en cualquier moneto
Answer: No because the chromosomes in the homologous pair can have different alleles for each gene, so a switch in a portion of the chromosome would affect the information in that chromatid.
(happy to help)
Explanation:
Answer:
why would this organism a close ancestor of humans evolve differently than us.
