1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
12

What does it mean when there is gradual change and buildup of organisms in an environment

Biology
1 answer:
olga_2 [115]3 years ago
4 0
Buildup of organisms means that the species number is pretty high.
Gradual change means that it was a slow, calm time to make the change.
I hope this helps!!
You might be interested in
A cell membrane is very specific about what it allows across how much does this help the cell
Lostsunrise [7]

Answer:

Transport proteins allows only enzymes to pass through the membrane

Explanation:

7 0
3 years ago
Read 2 more answers
A gland secretes enzymes through a duct onto the surface of a body part. Which gland is it most likely to be?
telo118 [61]
The answer is the salivary gland.

Saliva is secreted through the surface of the tongue.<span />
7 0
3 years ago
True or false? If you did not control variables in a experiment, there would be no way to know which variable explained your res
Mars2501 [29]
This answer is True.
6 0
4 years ago
Read 2 more answers
Suppose two students were experimenting with yeast to study cellular respiration. One student found glucose to be the most effic
iren2701 [21]

Answer:

The correct answer is statement c.

Explanation:

It is known that different strains of yeast may possess a differential choice for the molecules of sugars to be consumed. Like Saccharomyces cerevisiae strain may ferment sucrose, glucose, and raffinose, and other strain like Saccharomyces rouxii can ferment maltose and glucose, and the physical condition may change the consumption of sugar such that the strains of yeast at distinct temperatures may exhibit different efficacy of glucose consumption.

5 0
3 years ago
what effect does the nervous system have on the heart rate? stimulation by sympathetic nerves sets the resting heart rate of the
Julli [10]

The effect nervous system has on the heart rate is

Stimulation by parasympathetic nerves causes the heart rate to slow down.

The two branches of the autonomic (involuntary) nervous system regulate heart rate. The parasympathetic nervous system and the sympathetic nervous system (SNS and PNS) (PNS). To increase heart rate, the sympathetic nervous system (SNS) produces the catecholamines epinephrine and norepinephrine. The hormone acetylcholine is released by the parasympathetic nervous system (PNS) to reduce the heart rate. Your heart rate may briefly increase due to stress, coffee, and excitement, whereas it may temporarily decrease due to meditation or deep, steady breathing. Any amount of exercise will raise your heart rate, which will stay up as long as you keep exercising.

To learn more about nervous system here:-

brainly.com/question/13487019?referrer=searchResults

#SPJ4

8 0
2 years ago
Other questions:
  • When the environment changes, differences between individuals allow some plants and animals to survive while others die or move
    5·1 answer
  • These are the highly reactive elements located in Group 1 of the periodic table. These elements have one electron in their outer
    5·1 answer
  • Do you consider that “movement” is a characteristic of living beings? Do all living things move? Why?
    12·1 answer
  • Is RNA a nucleic acid that helps build proteins
    13·1 answer
  • 5 types of asexual reproduction.....?
    10·1 answer
  • How do human have a sense of taste, and why do they need it?
    10·2 answers
  • What are the two types of cholesterol and what do they do?
    7·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • What is the biggest part of the brain?
    13·1 answer
  • Some species blend in to their environments <br> through what
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!