1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
4 years ago
14

Through the 1973 endangered species act, __________ u.s. species have been listed as endangered or threatened with recovery plan

s approved or implemented for __________ species.
Biology
1 answer:
gizmo_the_mogwai [7]4 years ago
5 0
2,200 species, and recovery plans were approved or implemented for invasive species.
You might be interested in
In colorectal cancer, some tumor suppressor genes are inactive. This is an important factor resulting in uncontrolled cell divis
tresset_1 [31]

Answer/Explanation:

(1) a mutation in the coding region, resulting in an inactive protein

To check to see if there is a mutation, you could extract the DNA from the cancer cells and then perform PCR to amplify the gene of interest. You could then perform sanger sequencing and compare the sequence to the normal gene to see if a mutation is present. To test the effect of the mutation, you would want to see if an active protein has been formed.

To see if a normal sized protein has been formed, you could perform a western blot, comparing the protein band to the WT protein band. If the protein is absent or much smaller, it is likely not a functional protein.

(2) epigenetic silencing at the promoter of the gene, resulting in reduced transcription.

To check for changes in the epigenetic landscape of the promoter, you could perform chromatin immunoprecipitation by extracting the chromatin from the tumour cells and using antibodies for different chromatin marks to see what has changed between the normal cells and the tumor cells. E.g. H3K9me3, H3K27me3. You would perform a pull down with the antibody of interest and then PCR for your promoter to specifically look at changes at that gene compared to normal cells. To test DNA methylation, you could perform bisulfite sequencing.

To see how transcription is affected, you could extract RNA from the tumor and normal cells, and compare the levels of RNA between the two samples by qRT-PCR

3 0
3 years ago
1.______ from the sun is transferred to_____ surface. some of that energy is then _____
Roman55 [17]

Answer:

This is going by the number of blanks there are from the beginning

1.Energy

2. Earths

3. Transferred

4.equator

5.sun

6.causes

7.effect

Please give me Brainliest!

4 0
3 years ago
Choose the phrase that best describes West Germany after World War II.
sp2606 [1]
<span>B. democratic government

Western Germany was heavily backed by UK and United States compared to the communist Eastern Germany.


</span>
8 0
4 years ago
Compare and contrast saturated and unsaturated fats
gogolik [260]
Saturated fats are bonded together by single bonds, are found in animals, and are solid at room temperature; unsaturated fats are bonded together by double bonds that create a “kink”/bend, are found in plants, and are liquid or oil at room temperature.
6 0
3 years ago
charisma has a goldfish she keeps in a tank. she planted several underwater plants in the bottom of the tank. how are the goldfi
Paha777 [63]

Both are made up of cells, charisma has a goldfish she keeps in a tank. she planted several underwater plants in the bottom of the tank.

<h3>How long do goldfish live for?</h3>

Goldfish have a lifespan Of about 10-15 years, with some sorts living up to 30 years when occupied with proper maintenance.

Thus, Both are made up of cells.

To learn more about goldfish click here:

brainly.com/question/1940313

#SPJ4

6 0
2 years ago
Other questions:
  • What kind of Change makes iron to rust
    12·1 answer
  • What is true about a meal of a piece of salmon with garlic butter? high in fiber, low in protein. No vitamin B12, no iron, low i
    14·2 answers
  • What is a possible effect of leakage of inner ear fluid?
    9·2 answers
  • In a cross between individuals of a species of tropical fish, all of the male offspring have long tail fins, and none of the fem
    11·1 answer
  • The mechanism by which the end product of a metabolic pathway inhibits an earlier step in the pathway is most precisely describe
    12·1 answer
  • Which of the following is true about natural selection? ​
    12·1 answer
  • Need those 4 questions answered!! (Giving brainlest to whoever is first!)
    8·2 answers
  • 1. is the force that pulls objects towards Earth.
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • When ten or more pre-synaptic neurons conduct impulses to five or fewer post-synaptic neurons, the conduction pattern is said to
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!