1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
6

What is the difference between osmosis and diffusion

Biology
2 answers:
faltersainse [42]3 years ago
4 0
Osmosis<span> is the movement of water and is always the movement in the membrane.</span>Diffusion<span> does not need a membrane to make molecules and </span>Diffusion<span> is the movement of molecules.</span>
bija089 [108]3 years ago
3 0
Diffusion<span> is a spontaneous movement of particles from an area of high concentration to an area of low concentration. ... </span>Osmosis<span> is the spontaneous net movement of water across a semipermeable membrane from a region of low solute concentration to a more concentrated solution, up a concentration gradient.

</span>
You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
A student uses a string to model four pairs of homologous chromosomes in a parent cells. Each Chromosome pair is a different col
Arlecino [84]
<h2>Answer is option "C"</h2>

Explanation:

  • All in all, this procedure includes a "parent" cell parting into at least two "little girl" cells. Right now, parent cell can give its hereditary material from age to age.  
  • Meiosis, then again, is a particular type of cell division that happens in living beings that imitate explicitly. As referenced above, it produces regenerative cells, for example, sperm cells, egg cells, and spores in plants and parasites.  
  • In people, extraordinary cells called germ cells experience meiosis and at last offer ascent to sperm or eggs. Germ cells contain a total arrangement of 46 chromosomes (23 maternal chromosomes and 23 fatherly chromosomes). Before the finish of meiosis, the subsequent regenerative cells, or gametes, each have 23 hereditarily one of a kind chromosomes.
  • Hence, the right answer is option C "four strings, each a combination of different colors"

5 0
3 years ago
An ___ ___ is observed due to the unequal transport of charge by a transport mechanism that occurs across a plasma membrane.
insens350 [35]

Answer:

An electrogenic effect

Explanation:

An electrogenic transport is a process where there is a translocation of net charge across the membrane. E.g of electrogenic channels are Na+, K+, Ca2+, and Cl− channels.

7 0
3 years ago
The process of cellular respiration
Salsk061 [2.6K]
Cellular respiration<span> is </span>the process<span> of oxidizing food molecules, like glucose, to carbon dioxide and water. The energy released is trapped in the form of ATP for use by all the energy-consuming activities of the </span>cell<span>. </span>The process occur<span>s in two phases: glycolysis, the breakdown of glucose to pyruvic acid. </span>
5 0
3 years ago
Read 2 more answers
How does non-human life in an urban ecosystem differ from that in an undeveloped forest ecosystem? (Site 2)
Doss [256]
Non-human life differs from that because the environments are covered with like sewers, buildings, and roads. Green spaces such as parks, backyards, and undeveloped lots are scattered in among the developed areas instead of all connected together. Plants and animals have to deal with exposure to toxins from vehicles and loss of habitat and food sources.
3 0
3 years ago
Other questions:
  • What two properties are used to calculate kinetic energy?
    14·1 answer
  • What is one of the four elements that make up 96.3% of living cells
    15·2 answers
  • If your observations do not support your hypothesis, what<br> should you<br> you do?
    13·1 answer
  • The ara operon is an inducible operon that controls the production of the sugar arabinose. When arabinose is present in a bacter
    8·2 answers
  • Eras are divided into periods, which can be further divided into___?
    13·1 answer
  • ________ is the discipline of biology that focuses on classifying organisms and determining their evolutionary relationships. Ta
    12·1 answer
  • Please help ASAP!!!
    15·1 answer
  • Which is the one reason scientists produce transgenic organisms?
    6·2 answers
  • Two products are the result of photosynthesis. What is the waste product produced and released by the plant?
    15·2 answers
  • Match each field of study with its main focus.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!