1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
d1i1m1o1n [39]
4 years ago
12

Which of Earth's layers is shown by the letter Y in the image above?

Biology
2 answers:
natka813 [3]4 years ago
4 0

Answer:

Mantle.

Explanation:

Ksju [112]4 years ago
3 0

Answer:

Mantle.

Explanation:

easy ;)

You might be interested in
A scientist has chosen to study how rain can cause flooding along the Mississippi River. Which type of model is most appropriate
masha68 [24]
Is there a list of answers you can choose from?
3 0
3 years ago
Read 2 more answers
Choose all of the following that are examples of SECONDARY SUCCESSION? a. wild fire b. volcanic eruption c. glacier melting d. f
inn [45]

Answer:

i think it would be A for wild fire, D for flood and E for Tsunami

Explanation: wild fire are one of the most common ways for a secondary succession that can bring change when the environment is disturbed or damaged. For instance, by allowing fast-growing plants to grow and provide a source of food and shelter for many animals to use and eventually draw them back into the ecosystem. Both flooding and tsunamis help push older organisms and other stuff from the environment to create for room for other plants and animals to come and keep the ecosystem healthy and ongoing.

i hope this can help you with your work mate!

8 0
3 years ago
What is one way that cellular respiration differs from photosynthesis?
Ugo [173]

Answer:O The final product of cellular respiration is electromagnetic radiation.

The energy conversion in cellular respiration takes place in the chloroplast.

The main source of chemical energy in cellular respiration is water.

Explanation:

7 0
3 years ago
A geologist concludes that a rock sample is an extensive igneous rock. Based on this information, which statement about the rock
kramer
B I’m pretty sure if not it’s d But I always say go with ur gut but B
5 0
3 years ago
Which is the definition of adhesion?
cluponka [151]
The binding of a cell<span> to another </span>cell<span>, or a cell to a </span>surface<span>, via specific </span><span>cell adhesion molecules</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Please help asap!
    9·1 answer
  • Your dog becomes ill and you rush him to the veterinarian's office. A technician draws blood from your dog's leg for a vet-order
    5·1 answer
  • In the stomach, food becomes a very acidic, watery mixture containing enzymes that leaves the stomach a teaspoon at a time into
    7·1 answer
  • Which organelles work together in converting the potential energy of organic compounds into a suitable form for media used by th
    7·1 answer
  • Using complete sentences, answer the questions below. please help!
    9·1 answer
  • The lubber grasshopper is a very large grasshopper, and is black with red and yellow
    8·1 answer
  • Plz help I will mark you brainlist plz ​
    10·2 answers
  • DOY CORONA SI ME AYUDAN PLSS<br> que fases de la mitosis de observan en la imagen.
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Explain how the nervous system is related to the integumentary system. why is this important?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!