All categories

3 years ago

What are some ways to prevent wind erosion in a dry, sandy area

1 answer:

7 0

Preventing wind erosion in a dry, sandy area is feasible through any of the following land-use practices:

a. Tillage - creates soil roughness by making furrows and ridges that are perpendicular to the direction of the wind.
b. Crop rotation - rotations of legumes followed by shrubs followed by trees then back to legumes work best.
c. Intercropping - is the most widely used particularly in countries with desert areas. One of the most popularly used is oasis agriculture that makes use of about 3 layers of vegetation.

You might be interested in

I NEED ASAP!!! Which is an example of matter, the sound of thunder, sunlight, heat from a oven, or smoke from a fire?

Grace [21]

Answer:

D. Smoke from a fire

Explanation:

Smoke from a fire is the correct answer because it is made up of physical atoms. Sounds, light, and temperature are not made of atoms and are thus not matter.

5 0

2 years ago

Read 2 more answers

In a particular population the allele frequency of the ABO blood type alleles are as follows: r is 50%. IB is 49% and i is 1%. I

agasfer [191]

Answer:

26% is the percent of the population will have an A blood type (Option C)

Explanation:

Due to technical problems, you will find the complete explanation in the attached files

Download pdf

7 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

The inheritance pattern for an autosomal dominant trait is shown in the pedigree Shaded symbols represent individuals that expre

True [87]

Answer:the answer is c

Explanation:

And for biology to find answers download quizzes or socratic it helps you find the answers for problems like this fyi♥︎

3 0

2 years ago

Helllllpppppppp Aquatic questions ill give most points i got and brainliest

sergij07 [2.7K]

Answer:

11: Independent variable

12: Sink

13: Depends on whether your teacher will let you play once a lesson is over but in most classrooms I would say it is not allowed

14:Theory

15: Objective

16: 3

Explanation:

4 0

3 years ago