1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotegsom [21]
3 years ago
8

Which has makes up the largest amount of smog around cities

Biology
1 answer:
zavuch27 [327]3 years ago
4 0
Cars, Automobiles, transportation, the burning of fossile fuels (gas). Anything that mentions car or car functions lol
You might be interested in
Instrument for examining the uterus
podryga [215]

Answer:

speculum

Explanation:

6 0
2 years ago
Read 2 more answers
Juan and his friend Sam have been painting Juan's bedroom and they have created a great mural on one wall. In order to this, the
e-lub [12.9K]

Answer:

D on USA testprep

Explanation:

3 0
2 years ago
Read 2 more answers
Which are tunics (layers) that make up the gastrointestinal wall?
AlekseyPX

The gastrointestinal wall is composed of four layers or tunics:

  • Mucosa
  • Submucosa
  • Muscularis mucosa
  • Serosa

The innermost tunic of the wall is known as the mucosa or mucous membrane layer. The digestive tract's lumen is lined with it. The mucosa comprises epithelium, a layer of lamina propria, a loose layer of connective tissue, and the muscularis mucosa, a thin layer of smooth muscle.

The mucosa is surrounded by a substantial layer of loose connective tissue known as the submucosa. Blood arteries, lymphatic vessels, and neurons are also present in this stratum. The adventitia is a connective tissue that makes up the digestive tract's outermost layer above the diaphragm. It is referred to as serosa below the diaphragm.

To learn more about mucosa click here

brainly.com/question/13153021

#SPJ4

3 0
1 year ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Which organelle provides the energy for the cell to carry out protein synthesis
Dmitry [639]

Answer:

Mitochondria

Explanation:

Mitochondria produces energy rich ATP molecules.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Kyle is holding a bag of 250 jelly beans. When Mark takes out two jelly beans, Kyle is not able to tell a difference. This illus
    10·2 answers
  • Which of the following statements is an inference?
    10·1 answer
  • Help ASAP . the growth of the plants that reindeer used as food could not keep up with the needs of the reindeer population. wha
    5·1 answer
  • A scientist is analyzing tissue samples from an Asian elephant and an extinct woolly mammoth. When he sequences their DNA, he fi
    9·1 answer
  • Cells need energy in order to ________?
    7·2 answers
  • How does a change from atp to adp provide an organism with energy
    13·2 answers
  • Really need help please help me !
    5·1 answer
  • A farmer tested the soil in a field and found that there was a high nitrate salt concentration. The farmer then grew a crop in t
    6·1 answer
  • State two functions of a microscope​
    10·1 answer
  • On Earth, water is found naturally in all of these states EIXCEPT_.*
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!