1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ArbitrLikvidat [17]
3 years ago
13

The first electrochemical cell was invented by _____.

Biology
1 answer:
sattari [20]3 years ago
3 0
<span>The first electrochemical cell was invented by Alessandro Volta.

</span>
You might be interested in
In an experiment, Marlene removes the six anthers from the flower. What best describes the ability of the altered flower to form
Alik [6]

Ans.

In flowering plants, the male reproductive part or stamen is made up of a stack-like structure, known as filament and an ovule-like structure, known as anther. In anthers, microsporangia are present that produce pollen through mitosis.

Thus, 'if anthers are removed from a flower, it will not be able to form seeds as seeds are developed from zygote, that forms by the fusion of male gamete (pollen) and female gamete (ovum).'

3 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Detail the locations and fate of a glucose molecule in a French fry from the time you swallow it until it gets turned into CO2 a
sesenic [268]

Answer: the glucose is a weird circle thing and a french fry is a food.

Explanation: not really understanding the question here...

7 0
2 years ago
Need help here plss
levacccp [35]

Answer:

1) B

2) A

3) C

4) C

5) A

6) D

7) A

8) B

9) B

10) A

11) B

12) C

Explanation:

1) This shows that the rock occupies space as what we are looking at here is volume. (The displacement of water) Let's look at each of the options. It doesn't show that matter has mass because there is no mass balance or any equipment to show the heaviness of the rock. The state of matter (options C and D) is not shown here as any matter, which occupies space, when poured or added to an already filled glass will cause the water to spill. Option C says that matter is a solid, which is false as there are many different states of matter, such as solid, liquid and gaseous state. While a rock is a solid, the statement that matters are solid is false.

3) The term space is not commonly used in the study of science, we usually call it volume. This is because 'space' is quite a vague word as it could mean atmospheric space. More precisely, volume is the amount (or measure) of space a matter occupies.

4) Weighing scale measures the amount of mass (or weight) in a body. Options A and D are units of measurement for length while B is used for volume. Recap: volume is the amount of space an object occupies

5) Here, we are differentiating matter from non -matter

Properties that differentiate a matter from a non- matter are mass and volume. Matters have mass and occupies space (have volume).

6) I. Light is not a matter

II. All matter

III. Heat is not a matter. It is the measure of coldness or hotness in a body.

IV. All matter

9) Option C talks about diffusion.

10) An ion is a charged particle. For example, if an atom gains or loses an electron, it becomes negatively or positively charged and is now known as an ion.

A molecule is a group of atoms bonded together.

12) Atoms are very tiny so centimeters and millimeters would be too big of a unit for measuring them. Gram is a unit of measurement of mass.

<u>☆ Extra:</u>

Mass is the amount of substance in a body while weight is the amount of gravitational force acting on a body.

6 0
2 years ago
When a set of data is given, how is the mean, median, mode calculated​
vovikov84 [41]

mean is all values added together and divided by number if values. mode is most often. median is middle cross from both sides

4 0
3 years ago
Other questions:
  • Agents that can cross the placenta of a pregnant woman and cause birth defects are classified as
    9·1 answer
  • Which safe practice is part of using aseptic technique?
    12·2 answers
  • Scientists are constantly learning more and more about fossils because
    8·2 answers
  • Do you think scientists have an ethical obligation to speak out when a problem seems so severe
    15·1 answer
  • The reason the hypodermis acts as a shock absorber is that ________. it has no delicate nerve endings and can therefore absorb m
    11·1 answer
  • When selecting a vitamin-mineral supplement, choose one in which the nutrient levels are:?
    5·1 answer
  • The hypothesis that continents have moved slowly to their current locations is called
    13·1 answer
  • Select the correct answer.
    8·1 answer
  • Two steps that are important to follow in order to have a great business
    7·1 answer
  • Under normal conditions, some interstitial fluids slowly escape through the epidermis via a process called ______ water loss.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!