1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariulka [41]
3 years ago
11

If the size of a cell doubles, what will be it’s surface area to volume ratio

Biology
1 answer:
Gennadij [26K]3 years ago
6 0

<>"A further increase in the size of a cell could result in a surface area too small for adequate exchange of materials. Google: A large surface to volume ratio means that a small amount of living matter has a large surface through which nutrients, oxygen and wastes can diffuse."<>

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Is atmospheric nitrogen easily used by plants​
pickupchik [31]

Answer:

In addition to dinitrogen, other inorganic and organic forms exist in the soil as well.  It makes up 78 percent of the atmosphere but <u>cannot be used by plants. </u>It is taken into the soil by bacteria, some algae, lightning, and other means.

Explanation:

8 0
3 years ago
Explain how the elbow joint of a human and a cow is similar, but not identical in structure
son4ous [18]
<span>Both are warm blooded creatures. So you have humerus above and ulna beneath, which partake in the elbow joint. Both the dairy animals and human have pivot sort of joint with two insurance tendons to bolster the joint. The main distinction is that you have 180-degree pivot of humerus in human and not so on account of a dairy animals.</span>
6 0
3 years ago
What did humans in England do to change the tree trunks in mid 1800's?
Katarina [22]

Answer:

Scientists have discovered the specific mutation that famously turned moths black during the Industrial Revolution. In an iconic evolutionary case study, a black form of the peppered moth rapidly took over in industrial parts of the UK during the 1800s, as soot blackened the tree trunks and walls of its habitat

Explanation:

5 0
3 years ago
Read 2 more answers
2
yarga [219]

Answer:

B. The mutations were beneficial for each new environment.

Explanation:

3 0
3 years ago
Other questions:
  • Which combination of items below is INCORRECT? decomposers – bacteria and fungi pioneer community – lichens and mosses commensal
    9·2 answers
  • Ostealgia is ________.
    11·1 answer
  • What are two social factors that affect population growth?
    12·1 answer
  • Ally is a junior high student who has just learned about the carbon cycle in school. She is concerned about the environment and
    9·1 answer
  • What are the three components of a nucleotide
    13·1 answer
  • E. coli cells grown on 15N medium are transferred to 14N medium and allowed to grow for two more generations (two rounds of DNA
    10·1 answer
  • Fill in the blanks with the correct word or phrase.
    12·2 answers
  • What happens to the extinction when it is not over?
    14·1 answer
  • What are the important things we need to record while collecting the plants?
    6·1 answer
  • . Circle the letter of each sentence that is true about the light-dependent
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!