1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GalinKa [24]
3 years ago
11

7. What type of rock is formed by cooling magma or lava?

Biology
2 answers:
Rina8888 [55]3 years ago
6 0

Answer:

D igneous rock

Explanation:

adelina 88 [10]3 years ago
5 0

Answer:

igneous rock

Explanation:

You might be interested in
Which of the following chemical food preservatives is used in the wine industry but may cause asthmatic reactions in some indivi
alexandr1967 [171]

Answer:

<u>Sulfites</u>  are the chemical food preservatives which used in the wine industry but may cause asthmatic reactions in some individuals .

Explanation:

A chemical food preservative is a chemical species which are added to a product such as the beverages , food , drugs , paints , wood etc , to prevent  the process of degradation by microbes .

Sulfite is also an example of chemical food preservatives , sulfites helps the food from turning brown , in the presence of air .

Apart from helping the food from degrading , it too have same life - threatening symptoms for some people suffering from asthma .

Symptoms are - breathing difficulty , stomach cramps , tightness in the chest area , diarrhea .

Sulfites are used as a food preservatives in , wine , dried fruits , frozen potato , certain jams .

3 0
3 years ago
Why are frozen pipes a problem in very cold countries?? ​
Arada [10]
When it gets cold, the accumulated water inside the pipes freezes, expands and creates extreme pressure.
5 0
3 years ago
What is a distinguishing characteristic of primary succession?
gavmur [86]

Answer:

primary succession only occurs on bare rock

Explanation:

8 0
3 years ago
The original source of all genetic variation is _____. the original source of all genetic variation is _____. sexual reproductio
IceJOKER [234]
The answer for the above question is Mutation. 
Mutations are random spontaneous changes that occur suddenly in the DNA. A single mutation can have a large effect, however in may cases evolutionary changes are based on the accumulation of many mutations. The gene flow is any movement of genes from one generation to another and is an important source of mutation 
7 0
4 years ago
Science help thank you
DaniilM [7]

Answer:

I think it's d

Explanation:

I remember from a couple years ago I had to answer a question similar to this. I'm 90% sure I chose the last answer.

only choose my answer if you agree.

4 0
3 years ago
Other questions:
  • PLEASE HELP ASAP, WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    8·2 answers
  • A controlled experiment allows the scientist to isolate and test___________.a.a conclusion.b.a mass of information.c.several var
    10·1 answer
  • 5. Membrane receptors are specialized proteins that take part in communication
    13·2 answers
  • Which of the following statements accurately explains why most cells are
    10·2 answers
  • Which molecule brings amino acids to the ribosomes during protein synthesis?
    13·1 answer
  • A jellyfish is a type of cnidarian, a squid is a type of mollusk, and a dolphin is a type of vertebrate. Which two characteristi
    11·1 answer
  • The blood pressure in blood vessels decreases with the distance the blood travels, starting from when it was pumped out of the h
    15·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Are the oldest fossils in top layer, middle layer, or bottom layer? Explain why that is?
    13·2 answers
  • How are meiosis and mitosis similar?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!