1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
4 years ago
13

Homeostasis is maintained in a single- celled organism by the interaction of

Biology
2 answers:
Andrej [43]4 years ago
4 0
The answer is B I believe it to be
 
arsen [322]4 years ago
4 0

Answer: b

Explanation:

You might be interested in
Which of the following are true of a species? Select all that apply.
tatiyna

Answer:

the 1rst and 2nd

Explanation:

all fertile individuals can breed with one another and individuals vary genetically

8 0
2 years ago
In life cycles that alternate between haploid and diploid stages, ____________ acts to reduce the number of chromosomes per cell
777dan777 [17]

Answer:

meiosis_

fertilization

mitosis

zygote

Explanation:

In life cycles that alternate between haploid and diploid stages, ____meiosis_ acts to reduce the number of chromosomes per cell from two sets to one set. In life cycles that alternate between haploid and diploid stages, ___fertilization__ acts to double the number of chromosome per cell from one set to two sets. In life cycles that alternate between haploid and diploid stages, ______mitosis______ acts to keep the number of chromosomes per cell the same. In animals, a single diploid cell called a ____zygote________ divides by mitosis to give rise to all the cells of the adult body.

3 0
3 years ago
What process does a multicellular organism use to replace its damaged body cells?
Solnce55 [7]
Mitosis I think is the answer
7 0
3 years ago
Read 2 more answers
Proteins are used for all of the following except:
sveticcg [70]

Answer:

The answer is option D.

Signaling.

Hope this helps

4 0
4 years ago
The primary determinant of basal metabolic rate (bmr) is __________. the primary determinant of basal metabolic rate (bmr) is __
babunello [35]
I believe the primary determinant of basal metabolic rate is the Lean Body Mass. Basal metabolic is the rate of energy expenditure per unit time by animals at rest. It comprises the processes that the body requires to function. It is the amount of energy per unit time that a person need to keep the body operational at a state of rest.
4 0
3 years ago
Other questions:
  • Which term best describes the rate at which glacial erosion takes place
    5·1 answer
  • Which element would most likely bond with lithium and form an ionic compound?
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • In Drosophila, the genes for body coloration and eye size are on different chromosomes. Normal-colored bodies are dominant to eb
    8·1 answer
  • Which of these molecules is not formed by dehydration reactions?
    15·1 answer
  • What theory of hearing contends that the entire basilar membrane vibrates as a whole in response to a sound?
    12·1 answer
  • How do exogrya and pycnodonte differ from modern day oysters?
    8·1 answer
  • Write the two toles played by plants<br>in controlling air pollution.​
    9·2 answers
  • Project due tomorrow, help needed ASAP!!!
    12·1 answer
  • William Shakespeare's writings are thought to be a perfect example of which of the following? A. The Reformation B. The Enlighte
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!