1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
m_a_m_a [10]
4 years ago
9

Why are there no tall trees on the tundra

Biology
1 answer:
photoshop1234 [79]4 years ago
8 0
Use this website, I remember having this question and I used this site

http://www.alaskakids.org/index.cfm/know-alaska/Alaska-Geography/Tundra
You might be interested in
Name two lower gastrointestinal system procedures that involve an endoscope, and describe why they are done.
Bess [88]

the two lower GI system procedures that involve a endoscope is the colon, or rectum. They are done to diagnose or treat any irregularities or diseases

3 0
4 years ago
Read 2 more answers
How many neutrons are The process of fusion and fission are completely different. Fusion combines two light atoms together and f
EleoNora [17]

Answer:

Examples of fission and fusion

For example, the so-called hydrogen bomb (or H bomb) is actually a deuterium–tritium bomb (a D–T bomb), which uses a nuclear fission reaction to create the very high temperatures needed to initiate fusion of solid lithium deuteride (6LiD), which releases neutrons that then react with 6Li, producing tritium.

Explanation:

4 0
4 years ago
If the DNA sequence was ATTCGCTA what would the DNA paired sequence be
sertanlavr [38]
TAAGCGAT is the paired sequence
5 0
3 years ago
which protein complex recognizes the aauaaa sequence in pre-mrna and is required for the cleavage and polyadenylation of pre-mrn
ra1l [238]

Answer:

the fruits

Explanation:

exercising alot because you have to balanced properly and move

8 0
3 years ago
This is an organism that is made of many parts but cannot make its own food. They are classified by whether they have a backbone
quester [9]
Animals or the kingdom animalia
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following would not be found in the Protista, Fungi, Plantae, or Animalia Kingdom ?
    6·1 answer
  • Animal behavior researchers often refer to an activity associated with punishment or reward as a(n) A. stimulus. B. operant. C.
    13·2 answers
  • Asexually, fungi can reproduce by
    11·2 answers
  • The actions of internal organs are regulated by the part of the brain called the
    10·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What could result from the dividing cell mass in a blastocyst?
    11·1 answer
  • How can a mutation that causes a change in the structure or function of a protein be beneficial to an organism?
    6·1 answer
  • How ureotely and uricotely are adaptation?
    15·1 answer
  • What equals to 12 g into mg and 12 grams into ng? <br><br> Same for the second question?
    12·1 answer
  • Can a person be exposed to hiv by hugging or shaking hands with an infected person? a. yes, because the virus can be transmitted
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!