1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paul [167]
2 years ago
14

Use photosynthesis in a sentence

Biology
1 answer:
tatiyna2 years ago
8 0
Chlorophyll, which gives plants their green color, enables plants to turn sunlight, CO2, water, and a few minerals into new plant tissue through a process called photosynthesis<span>.</span>
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Streptomyces griseus produces the antibiotic Streptomycin, which inhibits protein synthesis by binding to ribosomes and preventi
VLD [36.1K]

Answer:

See the answer below.

Explanation:

Antibiotic-producing bacteria are generally known to have a mechanism that enables them to be resistant to their own antibiotics. The mechanism that enables them to be resistant to their own antibiotic depends largely on the mode of action of the antibiotic substance.  

Some of the popular mechanisms used by bacteria to counter their own antibiotic substance include a mutation in the target gene, production of enzymes that inactivate the antibiotic compounds, or efflux of the compounds.

<u>In the case of </u><u><em>Streptomyces griseus</em></u><u>, the inactivity of streptomycin has been linked with the production of a phosphatase inhibitor that prevents streptomycin from getting access to the target site. Hence, the organism is not harmed by its own antibiotic.</u>

7 0
2 years ago
Areas near oceans or large lakes tend to have more moderate climates than do areas far from large bodies of water. Which of thes
mihalych1998 [28]

Answer

B

Explanation:

Hope this helps

3 0
2 years ago
Read 2 more answers
The human genome contains about 3 billion base pairs. During the first cell division after fertilization of a human embryo, S ph
Nataly [62]

Answer:

5556

Explanation:

If a DNA polymerase synthesizes in average 50 nucleotides/second, that means that in three hours (10800 seconds) it synthesizes about 540000 nucleotides.

However, if the human genome is composed of 3000000000 (3 billion) base pairs (nucleotids), the minimum number of DNA polymerases (working in the same number of origins of replication) to finish the duplication of all the genome in three hours is 5555,5. (3000000000/540000). As we know there is no half polymerase, so we round to 5556.

5556 molecules of DNA polymerases acting on 5556  origins of replication are needed.

7 0
3 years ago
Read 2 more answers
The cell of humans contains 46 chromosomes and is about to undergo cell division. How many cells are created after meiosis? *
Elan Coil [88]
4 cells are created when cells undergo meiosis
8 0
3 years ago
Other questions:
  • A cartilaginous structure between the "throat" and the trachea.
    11·1 answer
  • Systolic and diastolic blood pressures are affected differently by exercise? what could account for the difference?
    10·1 answer
  • How can meteorologists use the jet stream to predict the weather
    6·2 answers
  • An organism's ___________ adaptations are its physical traits that help it survive in its environment.
    11·1 answer
  • Describe the source of food for the first 3 levels in the food chain and explain why it takes less land, water, air to produce a
    15·1 answer
  • PLEASE HELP NEED DONE BY END OF DAY! 100Points, no fake answers pls&lt;3
    9·1 answer
  • Based on the fossil, which organism evolved first
    6·1 answer
  • Cells are infected with a vesicular stomatitis virus (VSV) strain in which a viral gene (VSVG) is fused to the green fluorescent
    15·1 answer
  • Modern europeans may have acquired genes that helped them adapt to the cold and absorb more vitamin d through interbreeding with
    10·1 answer
  • How do amphibians differ from reptiles?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!