1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
3 years ago
9

Mosses, ferns, and lichens are primitive flowerless plants that usually reproduce by producing _______.

Biology
1 answer:
kondor19780726 [428]3 years ago
4 0
Mosses, ferns, and lichens are bryophytes. They are non-vascular and non-flowering plant and have a thallus-like body. They reproduce by production f spores, inside the sporangia, and connceted to a base called as sporangiophore, which attaches it to the thallus. 
You might be interested in
What is a lens?
Nimfa-mama [501]

Answer:

A or B

Explanation:

To be honest both are accurate.

5 0
3 years ago
Read 2 more answers
¿Qué se puede agregar a un átomo para hacer que un electrón sin valencia en el átomo se convierta temporalmente en un electrón d
NNADVOKAT [17]

Energía.

Explicación:

Generalmente, los electrones giran continuamente en las capas de los átomos. Si estos electrones se encuentran en las capas más externas de un átomo, se denominan electrones de valencia.

Son necesarios para las reacciones químicas de un átomo en particular con otro, a través de sus pérdidas o compartidas.

En los átomos sin valencia, sus capas más externas no tienen electrones en sus capas más externas, tales átomos son estables.

Sin embargo, si se suministra cierta cantidad de energía a dicho átomo, el electrón gana energía y, por lo tanto, se excita.

Por lo tanto, se mueven de niveles de energía más bajos a niveles de energía más altos, y hacen que el átomo sin valencia se convierta en valencia temporalmente, a medida que se mueven hacia la capa más externa.

Answer:

Energy.

Explanation:

Generally, electrons revolves continuously in the shells of  atoms.if these electrons are located in the outer most shells of an atom,they are refereed to as the Valence electrons.

They are needed for chemical reactions of a particular atom with another,through their loses or sharing.

In Non -valence atoms their outermost shells do not have electrons at their outermost shells,such atoms are stable.

However, if  certain quantity of energy is supplied  to  such atom, the electron  gains energy and therefore becomes excited.

They therefore move from lower energy levels to higher energy levels,and makes the non- valence atom becomes valence temporarily, as they move into the outermost shell.

5 0
3 years ago
How are environmental issues and food production related?
olga nikolaevna [1]

Answer: Food consumption and production have a considerable impact on the environment.  Food production contributes

Explanation: , for example, to climate change, eutrophication and acid rain, as well as the depletion of biodiversity. It is also a considerable drain on other resources, such as nutrients, land area, energy, and water.

6 0
3 years ago
Which test tube contained all components necessary for optimum fat digestion?
RideAnS [48]
B. cream+lipase+ bile
8 0
3 years ago
Las consecuencias de la sobreexplotación de los recursos naturales
alexira [117]

Answer:

Destrucción de hábitats naturales, tanto terrestres como marinos y otros acuáticos. Destrucción de ecosistemas de todo tipo. Extinción de especies animales y vegetales. Interrupción de las redes y relaciones tróficas.

Explanation:

5 0
2 years ago
Other questions:
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • You are studying a population of
    13·1 answer
  • With an occluded front, _____.
    15·2 answers
  • Legumes, a type of plant, require Rhizobia, a type of soil bacteria, to survive since these organisms fix nitrogen during photos
    12·2 answers
  • Where does DNA replication occur during the cell cycle? Why?
    8·1 answer
  • Question 5
    8·1 answer
  • Please help due today I’ll mark brainliest
    15·1 answer
  • Will give brainliest<br> What is this?
    8·2 answers
  • Name one of the people who's work contributed to Darwin's Theory of Natural Selection. In 2-4 sentences discuss that individuals
    5·1 answer
  • Erythrocytes live for a maximum of.......days whereas platelets live for ....... days
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!