1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novosadov [1.4K]
3 years ago
15

Hurricanes form over oceans but can move onto land areas. When this happens, the storm can cause major damage to wildlife. In 19

99, Hurricane Floyd hit some beaches and washed away thousands of sea turtle nests. What is the most likely consequence of this event?
The damage to the beaches caused the extinction of some turtle species.
The damage to the turtle populations resulted in more invasive species.
The loss of baby turtles changed the reproductive cycle of the adult turtles.
The loss of biodiversity caused changes to food webs in the turtle ecosystems.
Biology
1 answer:
Zanzabum3 years ago
7 0

Answer:

The answer is D. The loss of biodiversity caused changes to food webs in the turtle ecosystems.

Explanation:

You might be interested in
2. What is the main function of the a Reproductive System
vovangra [49]

to give birth to youg one

5 0
3 years ago
Which type of reproduction is when two cells come together to produce a new individual?
jenyasd209 [6]
Sexual reproduction:)
8 0
3 years ago
Read 2 more answers
Water molecules are polar with the oxygen side being
dezoksy [38]
Water molecules are polar with the oxygen side being, slightly negative and the hydrogen side being slightly positive.
4 0
3 years ago
Select all that apply.
timofeeve [1]
Mutalism, commensalism, and parasitism
7 0
3 years ago
Read 2 more answers
Which recent discovery led to a new understanding of how genetic mutations increase the risk of cancer? double helix structure o
icang [17]

Answer:

BRCA1 and BRCA2 genes

Explanation:

The BRCA1 and BRCA2 genes are tumor suppressor genes that encode breast cancer susceptibility proteins involved in repairing double-strand DNA breaks (DSBs) by the mechanism of homologous recombination. This mechanism uses the sister chromatid of the homologous chromosome as template for repairing DSBs. It has been shown that mutations in BRCA1 and BRCA2 genes alter the molecular mechanism of homologous recombination DNA repair, thereby mutations are not repaired appropriately and persist in the DNA of tumor cells.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which best describes the purpose of connective tissue?
    9·1 answer
  • Which process is used to transport molecules into the cell that are too large to move through the membrane?
    10·1 answer
  • Which of these help in the asexual reproduction of black bread mold
    5·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Some types of eukaryotic cells have more mitochondria than others.
    15·1 answer
  • After an RNA molecule is transcribed from a eukaryotic gene, portions called _____ are removed and the remaining _____ are splic
    13·1 answer
  • 1. ¿Qué es la sociedad civil? ¿Quiénes la conforman? ¿Por qué es importante para la democracia?
    15·1 answer
  • A student creates a dichotomous key to identify common household pets. What is wrong with this key?
    12·1 answer
  • What is an ecological pyramid and what is it used for
    10·2 answers
  • Do 100 people living in developing countries such as Nigeria have the same impact on the environment as 100 people living in the
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!