Answer:
The evidence from the eruption helps scientists study past climate changes and compare them to modern changes.
Explanation:
Essentially, they like to study an area of difference so that they can see what changes in that situation; and they are able to understand <em>what </em> would change in a study sample (letting them know what measures to look for)
Dideoxynucleotides are chain-elongating inhibitors of DNA polymerase, used in the Sanger method for DNA sequencing.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Relapsing, recovering requires time, motivation and support. managing withdrawal symptoms.
The correct answer is sand, silt, and clay. These three sediments are the ones who make up the C horizon. This layer is located right below the B horizon and which is known to be a delicate layer since it has a weak pedological development compare to others.
