1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rus_ich [418]
4 years ago
5

After repeated studying, Cressida is able to remember all of the state capitals. Now when she hears the word Michigan, she quick

ly thinks of the word Lansing. Cressida’s learning is most likely due to long-term potentiation, which __________.
Biology
1 answer:
g100num [7]4 years ago
3 0
Which strengthens synaptic connections
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
List 10 fruit that contain:
Viktor [21]

Answer:

vitamin c

Cantaloupe.

Citrus fruits and juices, such as orange and grapefruit.

Kiwi fruit.

Mango.

Papaya.

Pineapple.

Strawberries, raspberries, blueberries, and cranberries.

Watermelon.

vitamin a

You can also get vitamin A by including good sources of beta-carotene in your diet, as the body can convert this into retinol. The main food sources of beta-carotene are: yellow, red and green (leafy) vegetables, such as spinach, carrots, sweet potatoes and red peppers. yellow fruit, such as mango, papaya and apricots.

4 0
3 years ago
Read 2 more answers
Mitosis in plants occurs in localized areas know as meristems<br><br><br> A)True<br> B)False
Temka [501]
I think the answer is
true

hope i helped

8 0
3 years ago
Read 2 more answers
Polygons EFGH and E'F'G'H' are shown on the coordinate grid:
Igoryamba

Answer:

GJ

Explanation:

GY NJUU' GF8N

5 0
3 years ago
Experiments with isotopes used as tracers showed that some fungi _____. A. help plants get nutrients in exchange for sugar B. ta
Dvinal [7]

The answer I would choose is D. Help plants by providing them with sugar

You can tell me if i'm wrong.

6 0
3 years ago
Other questions:
  • Cross a pure A type blood with a pure B type blood;write the phenotype, genotype, and ratios
    12·1 answer
  • Porque me duele el estomago?
    15·1 answer
  • What events took place in anna's immune system when invaded by the s. marcescens infection? be specific in your response?
    10·2 answers
  • What is the formula to solve for mass in specific heat capacity?
    7·1 answer
  • Which tools measure the volume of liquid?<br> .
    10·1 answer
  • Calculate the volume of this regular solid.
    10·1 answer
  • BRAINLIESTTTT ASAP!!<br><br> What are the starting compounds in the process of cellular respiration?
    10·1 answer
  • 5. How does mitosis help a planarian clone itself?
    9·1 answer
  • The place where an oraganism lives and that provides the things it needs to survive is its
    12·1 answer
  • Need help ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Still have more work to do please help!!!!!!!!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!