1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olasank [31]
3 years ago
12

The cytoskeleton is an internal scaffolding used for cellular movement true or false

Biology
1 answer:
xeze [42]3 years ago
6 0
It's true :)))))))wooo woo
You might be interested in
What practice should an obese individual on a diet carry out
erastova [34]

Some foods and eating patterns may make it easier to keep obesity in check.  Healthy food choices and diet patterns that help prevent heart disease, diabetes, and other chronic conditions may also help to prevent weight gain.  

Eat whole foods-whole grains, vegetables, fruits, nuts, healthful sources of protein (fish, poultry, beans), and plant oils. Processed food should be minimal. Limit sugared beverages, refined grains, potatoes, red and processed meats, and other highly processed foods, such as fast food.


6 0
3 years ago
Read 2 more answers
Match the properties with the subatomic particles.
frez [133]

Answer:

Explanation:

There are three  known subatomic particles: Electrons, Protons and Neutrons

    Electrons                                                  

  • It has a charge of -1
  • It has negligible mass
  • it is found outside the nucleus

  Protons

  • It has a charge of +1
  • It has a mass of 1
  • It is found in nucleus

 Neutrons

  • It has no electrical charge
  • It has a mass of 1
  • It is found in the nucleus
8 0
3 years ago
Humans are not the only animals that cause air pollution.<br> A. True<br> B. False
garri49 [273]
The answer is true, pigs cause air pollution by releasing methane into the air.<span />
4 0
3 years ago
narvez 5. Everyone in Dobby's family has a long nose and they brag that they are from a purebred line. Viola has a stubby nose.
mote1985 [20]

Assuming a single diallelic gene coding for the trait and expressing complete dominance, the phenotypes, genotypes, and probabilities of getting each of them vary according to the parentals' genotypes. See the options below.

---------------------------------

Since I do not have the genotypes from #2, I will provide <em>different potential scenarios </em>for this question.

I advise you to <em>check on them</em> and see <em>which one matches the genotype from #2.</em>

Let us assume a single diallelic gene is coding for the trait and expresses complete dominance.

<h3 /><h3><u>SCENARIO 1</u>  ⇒ long nose is the dominant trait</h3>

Let us say that

  • L is the dominant allele and codes for long nose
  • l is the recessive allele and codes for stubby nose

Since long nose is dominant over stubby nose

  • LL and Ll ⇒ long nose
  • ll ⇒ stubby nose

If Dobby comes from a purebred family and has long nose, his genotype must be LL.

And if Viola has stubbi nose, her genotype must be ll.

<u>Cross 1</u>

Parentals)    LL   x    ll

Gametes)  L    L     l    l

Punnett square)    L       L

                      l      Ll      Ll

                      l      Ll      Ll

F1) Genotype ⇒ 100% heter0zyg0us Ll

     Phenotype ⇒ 100% long-nosed

  • <em>There is 100% chances for a child to have a long nose</em>
  • <em>There is 0% chances for a child to have a stubby nose</em>
  • <em>These children are not purebred</em>

                                             **********

<h3><u>SCENARIO 2</u>  ⇒ Stubby nose is the dominant trait</h3>

Let us say that

  • S is the dominant allele and codes for stubby nose
  • s is the recessive allele and codes for long nose

Since stubby nose is dominant over long nose

  • SS and Ss ⇒ stubby nose
  • ss ⇒ long nose

If Dobby comes from a purebred family and has long nose, his genotype must be ss.

And if Viola has stubbi nose, her genotype must be either SS or Ss.

There are two possible crosses.

<u>Cross 1</u> : Violet is h0m0zyg0us dominant SS

Parentals)    SS   x    ss

Gametes)  S    S     s    s

Punnett square)   S       S

                      s     Ss     Ss

                      s     Ss     Ss

F1) Genotype ⇒ 100% heter0zyg0us Ss

     Phenotype ⇒ 100% stubby-nosed

  • <em>There is 100% chances for a child to have a stubby nose</em>
  • <em>There is 0% chances for a child to have a long nose</em>
  • <em>These children are not purebred</em>

<u>Cross 2</u>: Violet is heter0zyg0us, Ss

Parentals)    Ss   x    ss

Gametes)  S    s     s    s

Punnett square)   S       s

                      s     Ss     ss

                      s     Ss     ss

F1) Genotype ⇒ 50% heter0zyg0us Ss and 50% h0m0zyg0us recessive ss

     Phenotype ⇒ 50% stubby-nosed and 50% long-nosed

  • <em>There is 50% chances for a child to have a stubby nose</em>
  • <em>There is 50% chances for a child to have a long nose</em>
  • <em>These children are not purebred</em>

----------------------------

You can learn more about single gene crosses at

brainly.com/question/12653314?referrer=searchResults

7 0
2 years ago
According to the endosymbiotic theory which two protist evolved from a symbotic relationship of organisms which resulted in euka
timama [110]
I think it's option (d) slime moulds
7 0
3 years ago
Other questions:
  • Adh helps to conserve water during dehydration. <br> a. True <br> b. False
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Scientist who specialize in the study of fossils are called
    7·2 answers
  • In the Linnaeus system, a(n) ________ contains similar phyla.
    5·1 answer
  • Ecology is the study of
    9·1 answer
  • Overexertion in extremely hot temperatures helps the body to cool itself. true false
    11·2 answers
  • What is the term used to describe an informal communication channel that carries information, often unofficial, in many differen
    11·1 answer
  • Not sure which one plz help
    8·2 answers
  • What are some kinds of worms that are harmful to people or pets?
    15·1 answer
  • The branch of the anterior ramus that contains autonomic neurons of the sympathetic nervous system is called __________. cervica
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!