1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
13

The region of a chromosome holding the two double strands of replicated dna together is called _____.

Biology
1 answer:
tino4ka555 [31]3 years ago
6 0
It is called a centromere. Hope this helps.
You might be interested in
When a body is buried directly in the soil, both toxic chemical products of decomposition and nutrient-rich decomposition fluids
ValentinkaMS [17]

Cadaver Decomposition Island

-  When a body is buried directly in the soil, then it is subject to decomposition by insects and microorganisms. 

<span>- </span>During this process, a self-digestion of the cells occurs as well as anaerobic decomposition of animal proteins resulting in a release of various chemical components.

<span>- </span>This nutrient-rich fluid is trapped in the soil matrix for a long period of time resulting in the formation of Cadaver Decomposition Island

<span>- The formation of Cadaver Decomposition Island is associated with increased microbial biomass and activity.</span>

7 0
3 years ago
Which of the following is the
expeople1 [14]

Answer:

you answer is b

Explanation:

your welcome :)

3 0
2 years ago
All animals are _______. edgen
Arada [10]

Please be rightly informed that all animals are composed of <u>cells</u>

<h3>Living organisms </h3>

Living organisms; be it plants or animals are any organic or living system composed of cells and function as an individual entity.

  • All living organisms share a number of key characteristics or functions such as movement, respiration, homeostasis, reproduction, growth, evolution, competition and others.

  • Animals and plants also posess systems such as the digestive, skeletal, transport, nervous, excretory, respiratory and reproductive system.

  • Living organisms are also taxonomically classified as either unicellular microorganisms or multicellular plants and animals

So therefore, please be rightly informed that all animals are composed of cells

Complete question:

What do all animals have in common?

Learn more about living organisms:

brainly.com/question/17259533

#SPJ1

6 0
1 year ago
Read 2 more answers
—PLEASE HELP QUESTION IS IN THE PIC——
omeli [17]
Hold on i’ll answer this in 5 minutes while i research it.
3 0
2 years ago
Which is a correct interpretation of this cladogram?
tatiyna
I think the answer is C, Lizards evolved after Sponges.
Based on the cladogram, the sponges are higher at the chart than the lizards, giving the impression that they came first.
Hope this helps!
4 0
3 years ago
Read 2 more answers
Other questions:
  • Why cannot a population keep increasing forever in an ecosystem?
    9·1 answer
  • Plz help! Will award brainliest! I just need help with the rest
    10·1 answer
  • Which object forms when a supergiant runs out of fuel?
    13·1 answer
  • Which of the following statements about 2,3-bisphosphoglycerate (BPG) binding is FALSE?
    9·2 answers
  • Some traits are inherited and some are acquired. Which of the following is mostly an acquired trait?
    10·2 answers
  • Genetic variation can be increased by???
    15·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which substances will make a salt when combined?
    6·2 answers
  • One of the most common plants in Atlantic salt marshes is cordgrass. periwinkle snails cling to the top of tall cord grass is du
    15·1 answer
  • Describe the path of energy through photosynthesis.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!