1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rainbow [258]
3 years ago
10

The sigmoidal relationship between prey density and per capita predation rate in a Type III functional response can be explained

by all of the following factors, except(A) Predator density.(B) Predator preference of prey switches.(C) Prey access to refuge.(D) Recognition of prey by predator.
Biology
1 answer:
Sladkaya [172]3 years ago
4 0

Answer:

predatory density.

Explanation:

According to my research on sigmoidal relationships, I can say that based on the information provided within the question this is explained by all except for predatory density. This is basically defined as the amount there are of prey hence density.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

You might be interested in
The idea that Earth orbits the sun is referred to as ____ of the solar system, because of the scientist who first proposed it.​
exis [7]

Answer:

E. The Copernican model

5 0
3 years ago
If the net force an object at rest is zero the object will remain at rest. <br> True or false
FromTheMoon [43]

True

Explanation:

If the net force on an object at rest is zero, the object will remain at rest. This is one of the postulates of newton's law of motion.

 Newton's first law of motion states that "an object will continue in its state of rest or uniform motion unless if it is acted upon by an external force. "

  • If no net force acts on a body, it will forever remain at rest.
  • The force on a body causes its motion and acceleration.
  • A body will continue in uniform motion if no external force acts on it.

Learn more:

Newton's law brainly.com/question/11411375

#learnwithBrainly

4 0
4 years ago
Patricia has been asked to collect soil evidence from a crime scene. what is the best way for her to efficiently and accurately
miss Akunina [59]

A. Any soil on the suspect should be collected and labeled
5 0
3 years ago
Are the Celosia Plant flowers the plant seeds?
poizon [28]

Answer:

Sow seeds will grow

Explanation:

6 0
4 years ago
Eli was comparing the temperatures at a desert site and a coastal sit that have the same latitude. He noticed that the nighttime
natta225 [31]

Answer: the color hot

Explanation:

4 0
3 years ago
Other questions:
  • Which structure does not appear on all vertebrate embryos?
    6·1 answer
  • A sperm cell has a tail 40 um long and a student draws it 40 mm long calculate the magnification
    11·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What statement best describes the temperature of ocean surface water
    6·1 answer
  • Which compound is the strongest acid? H2S HBr Li2O LiBr
    12·1 answer
  • Every Cell has<br><br>A cell wall<br>Cytoplasm<br>Both 1 and 2
    13·1 answer
  • If we have a plate that has 2500 colonies on it, can we use this plate to calculate CFU's
    11·1 answer
  • Erica is working in the lab. She wants to remove the fine dust particles suspended in a sample of oil. Which method is she most
    6·2 answers
  • Mendel used single gene (or monohybrid) experiments to describe his law of segregation. He used _______ characters (or dihybrid)
    12·1 answer
  • Question 4
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!