1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kramer
3 years ago
7

Which mechanism do sponges possess that makes a predator think twice before attacking it

Biology
1 answer:
kow [346]3 years ago
8 0
They produce toxins that make them poisonous. The sponge will produce toxins that could disrupt the metabolism of any organisms that dare to consume them. Most predators will be able to detect this toxin through their sense of smells which make them rather to avoid the sponge.
You might be interested in
Peter, who lived 200 years ago, had a house with no rats in it. One day, his wife
antiseptic1488 [7]

Answer:

1 is always rifht

Explanation:

i think so

6 0
3 years ago
30. Describe why air enters the lungs during inhalation. In your answer, include the the terms diaphragm, rib cage, and air pres
iVinArrow [24]

Answer:

When you breathe in, or inhale, your diaphragm contracts and moves downward. This increases the space in your chest cavity, and your lungs expand into it. The muscles between your ribs also help enlarge the chest cavity. They contract to pull your rib cage both upward and outward when you inhale.

4 0
3 years ago
To protect endangered species from becoming extinct, it’s highly recommended to raise the animals in protected areas such as zoo
Lesechka [4]
The answer would be A because if they are raised where every th ing is given to them they don't know how to do the normal functions they do naturally by themselves like hunt or maybe migrate.
8 0
2 years ago
Read 2 more answers
Please help me guys!!
erma4kov [3.2K]

Answer:

i don't really know but good luck

Explanation:

7 0
3 years ago
Why would dark moths have an advantage?
alexandr1967 [171]

Answer:

To study these moths, Dr. Kettlewell placed light and dark moths on the trunks of trees where he could observe them. The same birds would find the dark moth twice as often if the bark on the tree was light. This supported the idea that dark moths had a survival advantage in a dark forest.

4 0
2 years ago
Other questions:
  • what is the correct sequence for the events of mitosis, meiosis, fertilization, and birth in sexual reproduction?
    11·1 answer
  • The speed at which the arterial solution enters the body is termed
    12·1 answer
  • In a newspaper ad a scientist asked for volunteers to test a new theory on the speed of light by using a machine he invented how
    6·1 answer
  • When using a dichotomous key, it is important to always
    8·2 answers
  • Remodeling a kitchen to add additional cabinets to existing ones also means adding extra support. In a similar respect bone remo
    13·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following is the primary employer of natural resource professionals aPrivate landowners b Local governments c Unite
    12·1 answer
  • Who can be helped by building meaningful relationships with people of other
    5·1 answer
  • All sugars are considered:<br><br> a carb<br><br> a fat<br><br> just sugars<br><br> a lipid
    11·2 answers
  • What is the purpose of a flower?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!