1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valkas [14]
3 years ago
7

Explain how the gravitation force between earth and the moon would change if the distance between them increased

Biology
1 answer:
Vlad [161]3 years ago
3 0
The gravitional force that the earth has on the moon would be less because the distance increased
You might be interested in
The cell membrane contains channels and pumps that help move materials from 1 side to the other. What are these channels and pum
Anettt [7]
I believe proteins would be the correct answer, but of course I just learnt this stuff 2 weeks ago. xD
7 0
3 years ago
Read 2 more answers
What do transcription and translation have in common?
Juliette [100K]
They both take place in the nucleus :)
8 0
3 years ago
If the loop of henle was elongated, what would be the result on water extraction from urine?
Serggg [28]
<span>It would increase the water extraction due to the counter current multiplier system.</span>
4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
5. What do fossils of transitional links illustrate?
kicyunya [14]

Answer:A is the answer

Explanation:Hope you get it right

4 0
3 years ago
Other questions:
  • Briefly relate how the mouth and its structures adapt a frog to its terrestrial existence.
    13·1 answer
  • Which portion of the cell membrane is responsible for preventing unwanted materials from entering the cell?
    10·1 answer
  • In 1990, Carl Woese introduced the three
    12·2 answers
  • Ovulation involves the release of the _____________ from a vesicular follicle.
    10·1 answer
  • 1. Chemical weathering occurs more rapidly in what kind of climates?
    8·2 answers
  • What is incomplete dominance?
    6·1 answer
  • Which practice supports a circular economy?
    15·2 answers
  • This is not multiple choice..Please answer...if u don't know the answer just skip...and do not say "IDK ASK GOOGLE" I didn't fin
    12·1 answer
  • ¿Por qué los contaminantes son más dañinos para los consumidores terciarios en comparación con productores?​
    14·1 answer
  • Explain why it is not accurate to call a virus that kills bacteria a “bacteria eater."
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!