1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
3 years ago
13

Which of these factors is an advantage to using credit cards?

Biology
2 answers:
anyanavicka [17]3 years ago
8 0

Answer:

No fees or charges

Explanation:

APEX

jeka943 years ago
7 0
The correct answer is "good record keeping" on apex
You might be interested in
Which genre, introduced in the golden age of the musical, is characterized by increasingly serious plots and sophisticated music
Vika [28.1K]
The answer is musical drama
6 0
3 years ago
Why do you think air pressure is greatest at the lowest part of the atmosphere?
Alex777 [14]

Answer:

At sea level, air pressure is greatest because it is caused by the weight of the entire column of atmosphere at that altitude over that location. As altitude increases, the column of atmosphere gets shorter, and so less weight is pressing down at a given altitude, so atmospheric pressure is reduced.

4 0
3 years ago
Metabolic acids __________. are acid participants in, or by-products of, cellular metabolism can leave the body by entering the
Marianna [84]

Answer:

a. are acid participants in, or by-products of, cellular metabolism

Explanation:

cellular metabolism is the process in which several chemical recation stakes place in body. there aretwo type of cellular metabolism - catabolism and anabolsim, which serves for several body functions.

During the chemical reaction of cellular metabolism, many acids are produced which are called metabolic acids. Several metabolic pathways produces different acids such as carboxylic acid, citric acid and amino acid. All the metabolic acid maintains body's functional activities,if any case acid formation increases it causes metabloic acidosis.

Hence, the correct option is a. "Metabolic acids are the acid participants of celular metablosim".

7 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Which situation results in a characteristic that is
Citrus2011 [14]
It would be a young puppy learns to beg for food by watching a older dog
5 0
3 years ago
Other questions:
  • In a biology class, one student argues that tissues are the building blocks of organs. Another student argues that cells are the
    9·2 answers
  • Which would have more epitopes a protein or a lipid?
    13·1 answer
  • Which of the mechanisms listed below requires energy?
    10·2 answers
  • Gases pass in and out of a leaf through the what?
    7·1 answer
  • Which of the following biological processes occur in the cells of mitochondria
    5·1 answer
  • Genetic variation occurs when chromosomes are shuffled in fertilization and what other process?. mitosis mutation meiosis geneti
    14·2 answers
  • Nigel lives near a chemical plant that spews sulfur dioxide into the air. At first, Nigel could not stand the smell of the gas i
    11·2 answers
  • Temperature is related mostly to the
    9·1 answer
  • The small in holes found on the plant leaves are called ​
    9·1 answer
  • What is the difference<br> between science and pseudoscience?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!