1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashcka [7]
3 years ago
6

Why will discharge of sewage wastes into lakes and rivers having abundant varieties of fish eventually eliminate much of the div

ersity of fish?
A.) The amount of oxygen available will be markedly reduced.

B.) The waters will become turbid (cloudy), making it difficult for the fish to find their prey.

C.) The waters will be excessively heated with thermal pollution.

D.) The number of spots where fish can lay their eggs will be reduced.
Biology
1 answer:
Serjik [45]3 years ago
3 0
The waters will be excessively heated with thermal pollution
You might be interested in
Name the two kinds of endoplasmic reticulum
ehidna [41]
Rough and smooth ER is the two kinds
8 0
3 years ago
Read 2 more answers
A child has brown hair and brown eyes. his father has brown hair and blue eyes. his mother has red hair and brown eyes. the best
Elina [12.6K]
The child has inherited both the traits from his parents.
4 0
3 years ago
Which of the following is true concerning continental crust? a. It does not contain radioactive elements. b. It mostly contains
Phantasy [73]
<span>The mantle is more dense, so it can not B.
 Not even A , because the crust sure does contain naturally occurring radioactive material. Heat  is also not  efficiently transferred to the surface--most ground is cool,
so correct option is none is above that is D 
hope it helps</span>
3 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What is it called when the forest remains but its richness and well-being have deteriorated?
ira [324]

Answer: Biodiversity loss

Explanation:

The biodiversity can be defined as the variety of life forms on earth or any other region. The forests are rich sources of biodiversity. The hunting, poaching, animal trafficking, and other ill-legal related human activities are like to reduce the species richness in forests. As many species are dependent upon other species for food, mate and other requirements for completing the life cycle thus the well-being of the forests will get deteriorated by the loss of biodiversity.

8 0
3 years ago
Other questions:
  • The cell structures that break down nutrient molecules and old cell parts are known as
    6·1 answer
  • Label the internal structure of the earth
    15·1 answer
  • What happens to euglena when sunlight is not present?
    11·2 answers
  • A water-soluble hormone approaches its target cell. Which will happen first? (2 points) The hormone's signal will be transduced
    13·1 answer
  • How do greenhouse gases such as CO2 and N2O contribute to an increase in Earth’s atmospheric temperature?
    7·2 answers
  • An organism has a haploid number of 8. what is the organism's diploid number
    15·2 answers
  • 1. In an experiment to determine the effect of soil pH on plant growth, the plant growth represents the__________________
    15·1 answer
  • Burning oil and coal adds ______ to the atmosphere.
    15·1 answer
  • Based on the chart, Which system interactions are dependent on the plant's ability to respond to the direction of
    12·1 answer
  • Consider the following claim: Group behavior can increase the chances for an individual and a species to survive and reproduce.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!