1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fantom [35]
3 years ago
6

What steps occur in germination after water uptake?

Biology
1 answer:
AveGali [126]3 years ago
4 0
<span>here is the entire process, hope you can answer you question!
Step 1: Imbibition: water fills the seed.
Step 2: The water activates enzymes that begin the plant's growth.Step 3: The seed grows a root to access water underground.
Step 4: The seed grows shoots that grow towards the sun.
<span>Step 5: The shoots grow leaves and begin photmorphogenesis.</span></span>
You might be interested in
10. Which activity completes an enzyme-controlled
den301095 [7]

Answer:

C)

Explanation:

separation of the enzyme and the products of the reaction.

5 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
1) Which organelle of a cell contains its DNA? a) Mitochondria b) Membrane c) Cytoplasm d) Nucleus​
mixas84 [53]
D. Nucleus

Please give brainliest answer <3
8 0
3 years ago
Which best explains how the collisions of materials in space contribute to the formation of layers in protoplanets?
Sedbober [7]

Answer:The best explanation is;

The materials undergo decay when they collide, which results in the heating and subsequent melting and rising of materials

Explanation: A protoplanet is an embryo formed in a protoplanetary disc which has passed through a melting phase that enables the formation layered interior

In protoplanets the effects of partial melting of the components due to heating produced by radioactive decay and  pressures from forces of gravity there is segregation of the melt and igneous composition such that the heavier melted metal can sink and be over laid by the lighter igneous rocks

Therefore, the best explanation is that the materials undergo decay when they collide, which results in the heating and subsequent melting and segregation by the sinking of the heavier melted materials and rising of the lighter igneous materials.

8 0
3 years ago
Read 2 more answers
1.Every time we eat, which body system is in control of digesting the food that we consume?
zysi [14]

Answer:

1. A. digestive system

B. excretory system

2. A. nervous system

B. respiratory system

Explanation:

1. the digestive system helps digest food and the excretory system helps get rid of waste.

2. asthma is considered a respiratory disease.

hope it helped. :) please mark as brainliest if it did. thanks in advance. :)

3 0
2 years ago
Read 2 more answers
Other questions:
  • The fatty acids in the tail of a phospholipid molecule are _____. nonpolar and hydrophobic .... polar and hydrophilic ... negati
    13·2 answers
  • How many dna molecules are present in your diploid cells
    15·1 answer
  • Identify three similarities and three differences comparing the tundra to the following enviroments: the marine, freshwater and
    8·1 answer
  • What is a Degree Heating Week?
    13·1 answer
  • Is the crayfish most vulnerable to its enemies from the dorsal side or ventral side? why?
    11·1 answer
  • Yellowstone National Park has 124 wolves living in it. The park covers 3472 square miles. What is the population density of wolv
    15·2 answers
  • What are two major parts of compound microscope?​
    13·2 answers
  • what is the evidence that richard wrangham put forward to support his hypothesis that intraspecies aggressiveness was common in
    7·1 answer
  • Name some organisms that are producers
    10·1 answer
  • A ___ organism always produces offspring that are identical to the parent when self-fertilized.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!