1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nesterboy [21]
3 years ago
15

Can a human make amino acids or does he or she have to always get amino acids from eating food?

Biology
1 answer:
meriva3 years ago
8 0
Humans get amino acids from protiens in the food we eat. As we digest the food, the enzymes in our stomach and small intestines break down proteins into small amino acids. So technically, we do not make amino acids, we get amino acids from eating food high in protiens.
You might be interested in
Which cells allow the body to sense touch? A. melanocytes B. keratinocytes C. dendritic cells D. tactile cells​
irina [24]

Answer:

I think it is D. Tactile cells

3 0
3 years ago
The large number of antibodies that can be produced in a single individual is a result of a single B cell: producing multiple un
wariber [46]

The answer is; producing a unique antibody from all other B cells by genomic rearrangement.


An isolated B cell produces monoclonal antibodies (also called Immunoglobulins). Different B cell types produce different types of antibodies (hence the serum of an animal has polyclonal antibodies). Memory B cells are developed when a particular infection is eradicated by the immune system. These B cells proliferate when the infection returns by producing the same antibodies that were effective against the foreign entity.


6 0
3 years ago
Muscular exercise presents a dramatic test of the body's homeostatic control systems because it results in large _____.
kicyunya [14]

Muscular exercise presents a dramatic test of the body's homeostatic control systems because it results in large amounts of heat production.

Homeostatic control systems- A body's physiological ability to maintain a steady internal environment in response to changes in the external environment is known as homeostasis.

Heat Production- The term "thermogenesis" refers to the process through which energy is lost by producing heat with specialization.

Energy- In biology, cells frequently store energy in macromolecules, especially lipids and carbohydrates (sugars). When chemical bonds are formed, such as during the redox reactions of cellular aerobic respiration, energy is released.

Redox Reactions- A reaction that happens when an oxidizing material and a reducing substance come into contact.

To know more about the homeostatic control system, click on the below link,

brainly.com/question/3913414

#SPJ4

7 0
2 years ago
Considering the same population of cats as in Part A, what is the expected frequency of each genotype (TLTL, TLTS, TSTS ) based
zaharov [31]

Answer:

P = f(TLTL) = 0,16

H = f(TLTS) = 0,48

Q = f(TSTS) = 0,36

Explanation:

Hello!

The allele proportion of any locus defines the genetic constitution of a population. Its sum is 1 and its values ​​can vary between 0 (absent allele) and 1 (fixed allele).

The calculation of allelic frequencies of a population is made taking into account that homozygotes have two identical alleles and heterozygotes have two different alleles.

In this case, let's say:

f(TL) = p

f(TS) = q

p + q = 1

Considering the genotypes TLTL, TLTS, TSTS, and the allele frequencies:

TL= 0,4

TS= 0,6

Genotypic frequency is the relative proportion of genotypes in a population for the locus in question, that is, the number of times the genotype appears in a population.

P = f(TLTL)

H = f(TLTS)

Q = f(TSTS)

Also P + H + Q = 1

And using the equation for Hardy-Weinberg equilibrium, the genotypic frequencies of equilibrium are given by the development of the binomial:

p^{2} = f(TLTL)

2pq = f(TSTL)

q^{2} = f(TSTS)

So, if the population is in balance:

P = p^{2}

H = 2pq

Q = q^{2}

Replacing the given values of allele frecuencies in each equiation you can calculate the expected frequency of each genotype for the next generation as:

f(TLTL) = P = p^{2} = 0,4^{2} = 0,16

f(TLTS) = H = 2pq = 2*0,4*0,6 = 0,48

f(TSTS) = Q = q^{2} = 0,6^{2} = 0,36

I hope you have a SUPER day!

6 0
3 years ago
Layers of sediment are usually deposited by?
Bogdan [553]
I would say c is the answer

6 0
3 years ago
Other questions:
  • Explain how minerals form in diagram c
    9·1 answer
  • A patient presents to the emergency department with weight loss, petechiae, and splinter hemorrhages. the patient's vital signs
    10·1 answer
  • BRAINLIESTTTT ASAP!<br><br> How are food and oxygen made during the process of photosynthesis?
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Metabolic pathways are designed to synthesize necessary cellular reagents as required for cellular and tissue function. to accom
    15·1 answer
  • Health effects of stress can result in all of the following EXCEPT:
    15·2 answers
  • This picture shows the surface weather model at a particular location. Image shows a weather symbol with the following attribute
    6·2 answers
  • PLEASE HELP
    6·1 answer
  • How do our bodies use calcium?​
    6·2 answers
  • Recessive disorders related to genes found on the X chromosome but not on the Y are more commonly expressed in ________
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!