1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anon25 [30]
3 years ago
6

Which type of macromolecule is made of amino acids?

Biology
2 answers:
solniwko [45]3 years ago
7 0
Protein is the answer

Rudik [331]3 years ago
4 0
Protein. im absolutely certain
You might be interested in
True or false: During photosynthesis, CO2 is split to release oxygen gas. If false, make it a correct statement
KATRIN_1 [288]

Answer:

True

Explanation:

8 0
2 years ago
How does one-called organism grow ?
Alenkasestr [34]

Answer: Growing is capable to a certain living organism. Growth means getting larger in size, and for multi-cellular organisms this is done by making more cells. Plants have special tissues called meristems where growth occurs. Single celled organisms increase their numbers by dividing and making more cells like themselves.

Explanation:

7 0
2 years ago
What planet is referred to as a gas giant
Sophie [7]
There are actually two planets referred to as gas giants which are Jupiter and Saturn. These two planets are made of mostly helium and hydrogen which makes them gas giants, while Uranus and Neptune have more ice and rock substances, so they are not considered gas giants.
3 0
3 years ago
During dna replication in a human cell, 6 billion bases must be paired properly. which characteristic of dna best allows for hig
AleksandrR [38]

DNA polymerase III has a subunit for proofreading during DNA replication. As replication continues and the polymerase III enzyme detects a mismatched base pair, through a deformity in the double helix structure, the polymerase backs up, nicks the mismatched base and replaces it with the correct base before continuing replication.   





6 0
2 years ago
Read 2 more answers
All of the following are true about the structure of DNA EXCEPT
velikii [3]

Answer: I can not answer the question until you add the answer choices, but as soon as you do I will answer your question.

Explanation:

5 0
3 years ago
Other questions:
  • Provide an example of how surface area affects the function of an organ in the human body
    14·1 answer
  • Why is the age of a fault younger than the rock in which it is found?
    9·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What state of matter are icicles .
    12·2 answers
  • Can humans cause an imbalance in the food chain
    6·1 answer
  • PLEAS HELP ME
    7·2 answers
  • लख। b. Write any two differences between local and standard units of measurement. (स्थानीय र प्रमाणिक नाप उकाई बिच २ ओटा भिन्नता
    10·1 answer
  • How to describe diffusion and osmosis??
    15·1 answer
  • What was the second organism to be found here on planet Earth? *
    9·2 answers
  • The bones from an animal found at an archaeological dig have a C614 activity of 0.10 Bq per gram of carbon. The half-life of C61
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!