1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRISSAK [1]
3 years ago
5

If the concentration of sodium is greater outside a cell than inside the cell, which process could move sodium out of the cell?

Biology
2 answers:
Papessa [141]3 years ago
8 0
Diffusion occurs because of the movement of molecules from the region of higher concentration to the region of lower concentration. This movement of molecules occurs due to a thermal motion. Diffusion normally occurs between two compartments having difference in concentration. In case of fluid it moves from the region of higher concentration to the region of concentration until a balance is reached. The process of diffusion is very important for the humans as well. The oxygen that humans breathe in gets diffused with the blood.<span> 
</span>
Triss [41]3 years ago
6 0

Answer;

- Active transport

The process that could move sodium out of the cell is the active transport.

Explanation;

-Active transport involves the movement of particles or molecules across a membrane against a concentration gradient (from a region of their lower concentration to a region of their higher concentration).

-The mechanism of active transport requires the use of the cell's energy, usually in the form of adenosine triphosphate (ATP).

You might be interested in
PLSSSS HELP ME ASP!!!!
boyakko [2]

Answer:During transcription, the sequence of DNA is transcribed into mRNA. Later, during translation, mRNA sequence is translated into a protein molecule

Explanation:

i did it

4 0
1 year ago
Bodo
Arlecino [84]

Answer:

Saliva lubricates and moistens these food particles

Explanation:

As teeth help to break down large pieces of food into lots of smaller pieces, saliva is released and mixes with the smaller food pieces. Saliva lubricates and moistens these food particles such that a ball-like mixture of food and saliva that is known as a bolus is formed, which can then be easily swallowed.

7 0
2 years ago
What are all the different types of Skin Cancer?
Ainat [17]

Answer:

There are 4 main types of skin cancer:

Basal cell carcinoma. Basal cells are the round cells found in the lower epidermis. ...

Squamous cell carcinoma. Most of the epidermis is made up of flat, scale-like cells called squamous cells. ...

Merkel cell cancer. ...

Melanoma.

Explanation:

5 0
2 years ago
Read 2 more answers
How would planting a variety of plants in a vacant lot help establish an ecosystem in that location?
hjlf
Trees would help make a forest. Tall grass would help make a meadow. Hope this helps!
6 0
3 years ago
What are three species that can be raised (farmed) to take pressure off ocean species?
Juli2301 [7.4K]

Answer:

Seaweeds, shrimps, salmon

Explanation:

The rapid increase in the human population day by day has led to the increased usage of marine plants and animals. Due to this, the population f some marine plants and animals is declining to threatening levels.

To overcome his problem, scientists have devised the method of mariculture. This technique involves raising aquatic plants and animals in artificial lakes or ponds containing salty water just like in the oceans.

Some of these plants and animals are:

  1. Sea weeds: People might think that they do not consume sea weeds but it is actually present in most of our daily use products like toothpaste, ice creams and even in some automobiles. Many people from the world consume sea weeds as food. Hence, they are being raised in maricultures.
  2. Shrimps: Shrimps are favourite sea food among many people belonging to different areas. Hence, there population is declining due to which they need to be raised artificially.
  3. Salmon: The salmon is a kind of fish common to almost every nation. Hence, to meet the demands of people they need to be produced in maricultures.
4 0
3 years ago
Other questions:
  • Which organism lives in the human intestine and aids in the digestive process
    11·1 answer
  • Indicate if the following statements about prokaryotes are true or false. A. They contain a plasma membrane B. They contain inte
    6·1 answer
  • Mary marries an unaffected man, Justin, whose paternal uncle has galactosemia. Determine th genotypes for Justin’s Family
    12·1 answer
  • Interpret the genetic code to determine the amino acid coded for by codon ccu
    7·1 answer
  • Which of the following is not true about rattlesnakes?
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the difference between white and red blood cells?
    13·2 answers
  • What is the difference between hypnosis and meditation?
    13·1 answer
  • The major sources of amino acids
    5·1 answer
  • How does DNA technology help us compare organisms and model relatedness?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!