1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
3 years ago
5

Will fossil fuels ever run out

Biology
1 answer:
Anni [7]3 years ago
6 0
Well fossil fuels are a finite resource and at the rate we are using them, yes they will run out. but not anytime soon. but yes. we use them faster than they can be created. they WILL run out eventually.
You might be interested in
QUESTION 1:
Vikentia [17]
I think it’s true i think and D
3 0
1 year ago
15 points please help
Paha777 [63]
Circulatory system and nucleus
7 0
3 years ago
Which phrase best describes what a soil horizon is?
katen-ka-za [31]

Answer:

B. Each layer of a soil profile

Explanation:

I took the test and got it right

7 0
3 years ago
Darwin’s theory of natural selection applies only to birds. A. True B. False
Lesechka [4]
False, it was with any type of organism
8 0
3 years ago
Read 2 more answers
Why does all of the food produced by crops NOT make it to people?
bogdanovich [222]

Answer:

By the numbers, humans produce a lot of food—enough to provide every person on Earth 2,750 calories per day, exceeding almost all dietary recommendations.

There’s one glaring problem, however: Humans aren’t producing enough of the right food.

When researchers at the University of Guelph in Canada broke those calories down into different food groups, they found a shortage in production of the most important foods. In the long run, with the global population expected to balloon to about 10 billion people by mid-century, this could cause some serious problems.

Explanation:

6 0
3 years ago
Other questions:
  • Once the body has begun shivering, what happens to make it stop shivering?
    13·1 answer
  • Precipitation means things that _____________.
    10·2 answers
  • Is mineral movement into a plant root active transport or passive transport?
    5·1 answer
  • Sandy has a huge crush on Casey. When he is nearby, Sandy doesn't pay attention to anything or anyone else. Psychologist Donald
    7·1 answer
  • Every time there is a full moon, Mrs. Cook insists that students in her classes display strange behavior. What would be the best
    11·1 answer
  • How is cellular respiration related to photosynthesis?
    8·1 answer
  • What is otitis media
    7·1 answer
  • Why is it important for people to study environmental science.
    14·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Microscope differential count Complete the following steps: Focus slide at 4x using the coarse focus, then the fine focus MICROS
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!