1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viva [34]
2 years ago
9

GABA is a neurotransmitter that ______ postsynaptic activity. a. inhibits b. facilitates c. has no impact on d. dies after

Biology
1 answer:
mojhsa [17]2 years ago
8 0

Answer: Option A) inhibits

GABA is a neurotransmitter that inhibits postsynaptic activity

Explanation:

Gamma amino butyric acid, GABA, is an inhibitory neurotransmitter in that, once released to the synapse, it inhibits or check muscular contractions by suspending further activity of the adjacent motor neuron.

Thus, by this mechanism, GABA inhibits postsynaptic activity

You might be interested in
Phosphorous is an important component in which of the following?
Dennis_Churaev [7]
Atp is the answer..............
5 0
3 years ago
In humans, attached earlobes are recessive to free hanging earlobs. If two heterozygous free lobed parents mate, what is the cha
scoundrel [369]
Bellow I attached the punnet square you need. From it you can see, that the likelihood of producing an offspring with attached earlobes is 25% (ff)

7 0
3 years ago
What unifying theme brought the work of Mendel and Darwin together in the big picture of
fenix001 [56]

Answer:

A: Discovery of DNA as the genetic material

Explanation:

DNA is the genetic material and stretch of DNA that codes for a specific protein is called as gene. Discovery of DNA as genetic material provided the physical proof of Mendel's factors that were responsible for transmission of genetic traits in his experiment.

Discovery of DNA as genetic material also established that genetic variations among individuals of the species as described by Darwin are due to minor differences in their DNA molecules.

Hence, discovery of DNA as genetic material led to acceptance of both Mendel's law and Darwin's theory.

4 0
3 years ago
Which food has the most carbohydrates?
irinina [24]

Answer:

The answer would be peanuts, Which contain a total of 24 g of carbs.

Sorry if i'm wrong! i just went on a mini reasearch spree :3

8 0
2 years ago
Which of the following is not a concern about nuclear energy?
o-na [289]
Nuclear energy produces less carbon than fossil fuels
4 0
3 years ago
Other questions:
  • Example of copying information in DNA?
    15·2 answers
  • How are viruses different from bacteria
    13·1 answer
  • Three minutes into a cardiac arrest resuscitation attempt, one member of your team inserts an endotracheal tube while another pe
    8·2 answers
  • The term ______ refers to an organism's ability to survive and produce fertile offspring.
    5·1 answer
  • Explain why the chemical released from the injured fish may not cause an alarm response in other fish species
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • PLEASE HELP!!!
    9·2 answers
  • When scientist take the genes of two different species and combine them we call this
    9·1 answer
  • What are the three parts of an atoms
    6·1 answer
  • The most amount of energy is available at what level of an energy pyramid?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!