1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Finger [1]
3 years ago
8

Would you expect the tripeptide with the amino acid sequence –serine-threonine-tyrosine– to be found on the inner core or the su

rface of a cytosolic protein?
Biology
1 answer:
kompoz [17]3 years ago
8 0
<span>You would expect for this tripeptide to most likely be found on the surface of the cytosolic protein, interacting with the aqueous environment of the cytosol.</span>
You might be interested in
What term is defined as the aptitude of some individuals to be better suited for survival and reproduction?
Delvig [45]

Answer:

Evolution by natural selection.

Explanation:

According to Charles Darwin's theory of evolution by natural selection, some organisms possesses heritable traits that enable them to adapt to their environment compared with other members of their species. This will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

6 0
3 years ago
What are the three body regions of an insect?
ValentinkaMS [17]
The answer for this one is Head,Thorax,abdomen
6 0
3 years ago
Which of these facts is supported by the rock cycle?
Gre4nikov [31]
The "limestone" is supported by the rock cycle.
8 0
3 years ago
Read 2 more answers
How could research on mice or rats help answer our medical research questions — questions that are, after all, about humans?
GenaCL600 [577]

Answer:

you could disect them or observe what they do by doing things like putting them in a maze or seeing what they do in front of a mirror.

Explanation:

4 0
2 years ago
Circulation to and from the lungs is referred to as
horsena [70]

Answer:

pulmonary circulation

Explanation:

The pulmonary circulation moves the blood between the lungs and heart. Since the blood carries oxygen the heart pumps it to every body part including the lungs so we can maintain homeostasis.

8 0
3 years ago
Other questions:
  • Are the elements in Figure 6-2 metals or nonmetals?
    9·1 answer
  • Describe how elements joining together to form chemical compounds is similar to the way the letters on a computer keyboard join
    15·1 answer
  • Why are fossils generally going to be more useful for studying animals that lived in or near water (e.g., streams, lakes, oceans
    9·1 answer
  • Why do you think a fracture involving the bones of the nasal cavity could affect the cranial cavity?
    7·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which of the following is the best explanation for why it is important to follow lab safety guidelines? a. Following laboratory
    8·2 answers
  • Which statement is evidence of the effects of the availability of resources on the number of wolves or caribou?
    11·2 answers
  • Which of the following is a difference between DNA and RNA?
    10·1 answer
  • Why an apple and a glass of milk can give you more nutrition as compared to the milk shake Prepared from apple and milk. Justify
    9·1 answer
  • characterization of n-2-fixing plant growth promoting endophytic and epiphytic bacterial community of indian cultivated and wild
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!