1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lord [1]
3 years ago
13

Plz Plz help me on this question what does the mRNA do?

Biology
1 answer:
ella [17]3 years ago
8 0
MRNA (messenger RNA) carries genetic information copied from the DNA in a series of three-based codes which specifies an amino acid

:))
You might be interested in
What is structure X?<br> A. Chromatin<br> B. chromosome<br> с. DNA<br> D. Chromatid
Anna35 [415]

Answer:

C

Explanation:

hffhbguhvcrzrx9txt8c9y

6 0
3 years ago
Biology homework assignment question please help!!! Will give BRAINLIEST if right.
ikadub [295]
A,C,D Is the answer to the question
6 0
3 years ago
Read 2 more answers
David is a 60-year-old smoker that has developed emphysema. This condition affects the lungs and prevents them from exchanging c
tekilochka [14]

Answer:

He must get oxygen from the hospital

7 0
3 years ago
See picture below!!!!!! :D
Marina86 [1]
1930-1950  hope this helps
6 0
3 years ago
Read 2 more answers
What type of energy is almost always Released during energy Transformation
Viktor [21]

Answer:

Someone plzz answer this i need the answer to.  

Explanation:

8 0
3 years ago
Other questions:
  • In allergic responses the body's immune system attacks allergens (such as pollens, venom, etc.). However, in autoimmune diseases
    11·2 answers
  • Which is considered the first stage of the cell cycle?
    13·2 answers
  • ____________________ can happen anywhere along the spine if the neural tube does not close all the way. The backbone that protec
    10·1 answer
  • Which type of protein will fight disease?<br> insulin<br> antibodies<br> ligaments<br> genes
    13·2 answers
  • When an animal runs along the ground by flexing some of its muscles, what causes its muscles to contract?
    5·2 answers
  • Pls can some one tell me the sources of inorganic fertilser
    14·1 answer
  • ------------is based on the biological integrity of the human organism. The level of susceptibility to disease, body weight, vis
    11·1 answer
  • What are the 2 main sources of genetic variation
    8·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Read each of the statements that describe the function of a cell cycle regulator. Then drag each sentence into the correct categ
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!