1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lyrx [107]
4 years ago
8

In meiosis II what happens during anaphase?

Biology
2 answers:
Elena-2011 [213]4 years ago
8 0

Answer:

Pulling apart or separation of sister chromatids

Explanation:

Meiosis is a type of cell division that results in four daughter cells with each having half number of chromosomes as the parent cell. It is the cell division that leads to formation of gametes to enable sexual reproduction. Division occurs twice during meiosis because before the two halves of a duplicated chromosome called sister chromatids separate, it still needs to separate homologous chromosome, which is a similar but non-identical pair of chromosome received from both parents. Hence, meiosis occurs in a two step division process i.e. Meiosis I and Meiosis II.

Meiosis II is the mitotic division of each of the haploid cells produced in meiosis I. Note that, homologous chromosomes separate in anaphase I of meiosis I, and further undergoes cytokinesis (division of cytoplasm) to produce two haploid (reduced number of chromosomes) daughter cells.

During anaphase of meiosis II, the individual chromosomes (sister chromatids) separate at the centromeres (point of attachment between two sister chromatids). The separated chromosomes are pulled apart towards each pole of the cell by the spindle fibres.

algol134 years ago
4 0
Meiosis II the chromosomes are pulled to the center of the cell and line up randomly at the equato
Anaphase II the centromere of each chromosome splits -the sister chromatids separate and move to opposite poles

You might be interested in
What types of animals exist in the third trophic level of an aquatic ecosystem​
mr_godi [17]

Answer:

 Juvenile stages of fish and jellfish, small fish, crustaceans and sea stars

Explanation:

hope it helps and give brainliest

8 0
2 years ago
Pls do this question
andrezito [222]

Answer:

C.

Explanation:

hope it helps

give me brainliest

3 0
2 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What is the gradual sequential regrowth of a community of species after a forest fire ?
dsp73
The answer is Succession.  It is the gradual sequential regrowth of a community of species after a forest fire.  Particularly, Secondary Succession, which is the sequential replacement of species that follows disruption of an existing community (natural disaster or forest fire)
7 0
3 years ago
I need help with this please help me!!
iVinArrow [24]

Answer:

i need help with this too somebody help

Explanation:

3 0
3 years ago
Other questions:
  • What is the function of the organelle identified in the picture? A) movement B) houses the cell's DNA C) houses the digestive en
    6·1 answer
  • Which organic molecule is part of an enzyme
    11·1 answer
  • He use of the isotope 32p as a tracer element in the study of invasion and lysis of bacteria by viruses has shown that
    10·1 answer
  • Unwrapped food placed in a freezer experiences dehydra- tion, known as “freezer burn.” why?
    5·1 answer
  • A medical student makes a frontal cut of a cadaver's abdomen. The two new sections of the abdomen could be referred to as the?
    11·2 answers
  • PLEASE HURRY 80 POINTS Circulatory System
    14·1 answer
  • The process that results in the formation of different cell types occurring through selective changes in genetic activity that c
    14·1 answer
  • Which of these is an organism?
    10·1 answer
  • What do you think life is like on other planets ? 3-5 sentences
    13·1 answer
  • O C. mitochondria 2. Where is the major site of photosynthesis in a plant? * O A. the stem O B. the roots O C. the leaves​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!