1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Step2247 [10]
3 years ago
8

Water is essential to all living things. one important attribute of water allows it to maintain a constant environment within ce

lls. which property of water allows it to do this?
Biology
2 answers:
Yuliya22 [10]3 years ago
8 0

I believe the answer is moderate temperature

Temperature will influence the structure of an molecule and the speed of enzyme. An organism will have an ideal temperature range where their cell can work efficiently, but the temperature of the environment could changes tremendously by the sunlight exposure. Water have high heat capacity and could provide a relatively more constant temperature which could protect the organism from immediate harm.

Dovator [93]3 years ago
7 0

Water is essential to all living things. one important attribute of water allows it to maintain a constant environment within cells. Moderate temperature allows it to do this.

Temperature moderation is defined as the act of controlling or regulating the temperature. Fans and air conditioners are some of the ways of controlling temperatures.

You might be interested in
As a rule, the teeth in a given mammal's mouth look very similar because they all have the same function.
Sholpan [36]

Answer: False

Explanation:

The teeth of mammals do not have the similar function to perform. They have different types, number and sizes of teeth that are equipped to perform different functions.

Example: Human beings have incisors,canines, molar and premolar. The incisors are used to cut the food and hold the food.

The canines are use to tear hard food such as meat. The molars and premolars are used to grind the food.

Hence, the given statement is false.

5 0
3 years ago
Regulation of internal environment​
Svetlanka [38]

Answer:

The regulation of an internal environment is called homeostasis.

Explanation:

Homeostasis is when you can maintain a stable inner environment.

8 0
2 years ago
Read 2 more answers
Describe one way in which osmosis is similar to simple diffusion and one way in which it is different.
Maslowich
Water or other molecules move down their concentration gradient without any energy.........

difference - simple diffusion uses help of transporting protein in the membrane whereas osmosis uses no help.
7 0
2 years ago
What location will enter darkness next as Earth's rotation continues ?​
Nataliya [291]

Answer:

well for me I think it's

Explanation:

the B

4 0
2 years ago
Read 2 more answers
Which is more active in cellular respiration: a germinating or a non germinating pea?
Morgarella [4.7K]

A germinating seed. This is due to the fact that the cells of a germinating seed are actively dividing as the plumule and radicle grow. This growth requires energy and this is derived from cellular respiration of the stored food in the cotyledons.  






7 0
3 years ago
Other questions:
  • What are the main forms of vegetation in a desert? Why?
    13·1 answer
  • What are the 4 differences between eukaryotic/ prokaryotic
    15·2 answers
  • Which process works by applying pressurized water against a semi-permeable membrane that traps salts and other minerals?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Assume that the import of a particular amino acid across the plasma membrane is observed (1) to occur only down its concentratio
    9·1 answer
  • Total Pieces of Food Eaten 57 153 90 Food Percentage* 19 % 51 % 3 % Simulated Number of Birds in Flock for 2nd Generation**
    12·1 answer
  • Woven bone Select one: a. has its collagen fibers randomly oriented. b. has a porous appearance. c. is organized into thin sheet
    11·1 answer
  • Skeletal muscles are known as​
    14·2 answers
  • Which table is correct about energy formation in plants?
    7·1 answer
  • I ask for help as quickly as possible please and thank you
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!