I pretty sure it is because the earth is bigger than the moon
An adaptation-----------------------
Answer:
AUG
can u mark me brainliest plz?
Explanation:
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
18 g
Explanation:
Remember that 1g is equivalent to 1 ml;
1g = 1 mL
100 g = 100 mL
Therefore in an 18% NaOH solution, for every 100 mL, there is 18 g of dissolved NaOH. This is how we derive the percentage solution;
18 g / 100 g = 18%
