1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
3 years ago
8

How tall does a pony have to be to be considered a horse?

Biology
1 answer:
Taya2010 [7]3 years ago
5 0
It should be about 5 ft
You might be interested in
What organelle does the mRNA strand go to so protein synthesis can start?
sergiy2304 [10]

Answer:

The mRNA strands go to the cytoplasm to meet ribosomes so protein synthesis can start.

Explanation:

In protein synthesis, the first step is to <em>synthesize messenger RNA</em>, mRNA. The coping process of the DNA section for the desired protein is called <u><em>transcription</em></u>, and it happens in the <em>nucleus</em>. After that, it occurs <em><u>translation</u></em>, when the formed <em>mRNA moves to the </em><em>cytoplasm</em> through the nucleus membrane pores. Protein synthesis is initiated in the cytoplasm when mRNA meets a free ribosome, the primary structure for protein synthesis. Ribosomes are made of <em>protein and ribosomal RNA</em> and can be found in the r<em>ough endoplasmic reticulum</em> or floating in the <em>cytosol</em>. They read the mRNA code and add the correct amino acid using <em>transference RNA</em> to build the protein. mARN has a <em>start and end codon</em> that tells where to start and stop adding amino acids. When the ribosome reaches the end codon, it means that protein synthesis is finished. The new protein is driven to the rough endoplasmic reticulum and translocated to the lumen. Once there, the protein suffers a few modifications, one of them is <em>folding</em> to become functional. Finally, protein is transported by vesicles to the Golgi complex, and from there to its final destiny.  

8 0
3 years ago
When the oxygen is used to break down in cellular respiration, what does it release ?
lawyer [7]

Answer:

Cellular respiration is the aerobic process by which living cells break down glucose molecules, release energy, and form molecules of ATP. Overall, this three-stage process involves glucose and oxygen reacting to form carbon dioxide and water.

3 0
2 years ago
A metamorphie rock can be classified according to its
Sergio [31]

Answer:

A metamorphic rock can be classifies according to its texture and compositions.

Explanation:

3 0
3 years ago
Water molecules stick to other materials due to its polar nature. This property is called
denis23 [38]
The property is called Adhesion 
8 0
3 years ago
The food plants is...<br><br> A. Carbon dioxide <br> B. Oxygen<br> C. Water<br> D. Glucose
xxTIMURxx [149]
Your answer is carbon dioxide because Chlorophyll can make food the plant can use from carbon dioxide, water, nutrients, and energy from sunlight. ... During the process of photosynthesis, plants release oxygen into the air.

I hope this helps
5 0
3 years ago
Other questions:
  • Which of the following is the correct order of organizations of structures in living things from simplest to most complex?
    12·2 answers
  • What properties does a wave model of light help explain?
    15·1 answer
  • Which of the following accurately describes the binomial nomenclature naming system?
    5·2 answers
  • Which blow from west to east, following the boundary between hot and cold air?
    13·2 answers
  • Which group began farming and living in villages? selected:
    13·1 answer
  • Which of the following is a good reason for why tobacco smoke is considered a carcinogen?
    11·2 answers
  • If in humans, brown eyes are dominant over green eyes, and two heterozygous parents have three children, what is the probability
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What does Binomial Nomenclature mean? (In the grand scheme people! No one-word answers!)
    6·1 answer
  • Explain why you would recommend the nguni cattle meat to consumers in your locality?​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!