1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Citrus2011 [14]
4 years ago
9

Which process allows a mammal to continue to

Biology
2 answers:
DerKrebs [107]4 years ago
4 0
If you're referring to one mammal in particular, then it should be the mitosis of body cells. Body cells do not perform meiosis as that is only for gamete production, therefore, it only happens in sex cells. In contrast, body cells will create identical copies of themselves so the organism can grow through mitosis. I hope that helps!
alex41 [277]4 years ago
3 0
Remember that Mitosis comprises the somatic cells that is vital for individuals growth.
while Meiosis comprises the division of two gametes,which the cell genetic's information.

eliminate 1,3, 4 because meiosis is for somatic cells. also it is not responsible for growth.

the best answer should be number 2, mitosis of body cell it carry out to develop complex organisms as a means of maintaining the organisms.
You might be interested in
Which of the following shows all of the tripeptides that can be formed from one molecule each of lysine (Lys), threonine (Thr),
Ierofanga [76]

Answer:

LysThrHis, LysHisThr, HisLysThr, HisThrLys, ThrLysHis, ThrHisLys

Explanation:

You easily combine the options for the tripeptide if you made a chart

Also you can calculate the posibilities with the factorial function in the calculatio (x!): 3*2*1 (you can multiplicate the number of amoniacids by the followed numbers until 1) = 6

7 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Suzy is interested in purchasing a DVD player, and is overwhelmed by the many different models available at her local electronic
artcher [175]

Answer:

A. peripheral                  

Explanation:

Peripheral route to persuasion: In psychology, the term "peripheral route to persuasion" is described as one of the two different types of persuasion method and generally occurs when a specific listener or person thinks or decides to get agree with the given message or information dependent on any other cues apart from the strength or quality of any idea or argument related to the given message.

Example: An individual decided to buy something because the outside appearance fantasizes him or her.

In the question above, the given statement signifies the "peripheral route to persuasion".

8 0
3 years ago
Why does a compressed air can become extremly cold when you use it?
BartSMP [9]

Answer:

The reason the compressed air gets cold after being used is due to a process known as adiabatic cooling, a property of thermodynamics. A gas, initially at high pressure, cools significantly when that pressure is released. The compression needed to turn a gas to liquid allows a large amount of gas to fit in a relatively small space, and when that gas is released to a large space, it rapidly expands to fill the space.

4 0
3 years ago
explain how repressible and inducible operons differ and how those differences reflect differences in the pathways they control
Sonja [21]

Answer

Operons are cluster of coordinated genes, including structural genes, an operator gene, and a regulatory gene.

Explanation:

In the The repressible operons, The transcription is usually on and repressor is in inactive form, So the specific genes are transcribed. While a regulatory molecule act as corepressor and binds to repressor protein to activate it. The repressor protein cause the inactivation of repressible operon (as the name indicate). E.g., Tryptophan Repress the trp operon.

A high level of product act as regulatory molecule (Corepressor) and turn off the operon, So anabolic pathways or synthesis of essential components are controlled by repressible operon.

In the Inducible operons, the transcription is usually off and repressor is in active form. So there is no transcription of genes. Specific Metabolite cause the activation of operon  e.g lactose cause the induction of lac operon.

As a metabolite induces the operon, So they control the Metabolic pathways or breakdown of a neutrient.

7 0
3 years ago
Other questions:
  • Members of the kingdom Animalia are best
    11·1 answer
  • In the scientific method ,what step follows making a prediction
    8·2 answers
  • Which of the following is transmitted by Aedes mosquitoes?A. yellow feverB. both dengue fever and yellow feverC. malariaD. dengu
    8·1 answer
  • During which process is mRNA converted into a sequence of amino acids for protein production?
    9·2 answers
  • How does a cell react in salt water
    6·2 answers
  • Explain how trees help maintain air quality.
    12·2 answers
  • Which correctly lists three characteristics that are used to describe air? altitude, density, radiation O density, radiation, ma
    13·1 answer
  • PLEASE HELP, I only have one attempt
    8·1 answer
  • Compare the growth of mutated cells with and without growth factors​
    13·1 answer
  • What are the most likely percentages for offspring of two red/white-feather parents?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!