Answer:
<u>Repeat a behaviour.</u>
Explanation:
When we adopt a new behaviour, a neural pathway is created and it gets stronger when we repeat until it become a new normal behaviour or a habit. When a message travels in a same neuronal pathway again and again, the brain begin to transmit it even more faster and these behaviours become automatic.
D) Blue Jays and Finches nest in the same Oak Trees.
Explanation:
This is an example of competition because two species are for the same thing, in this case, oak trees to nest in.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
I think the answer will be setting