A) genotype
Because the genotype means the genetic make-up of the cell, so saying that the genes of the plant are homozygous dominant show this genetic make-up of the plant.
Answer;
The above statement is true
Explanation;
-Complement is a system of plasma proteins that can be activated directly by pathogens or indirectly by pathogen-bound antibody, leading to a cascade of reactions that occurs on the surface of pathogens and generates active components with various effector functions.
-C3b is the larger of two elements formed by the cleavage of complement component 3, and is considered an important part of the innate immune system. C3b is potent in opsonization: tagging pathogens, immune complexes (antigen-antibody), and apoptotic cells for phagocytosis.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
<span>Cell code for enzymes that can convert other molecules into carbohydrates, nucleic acids and lipids. Humans can synthesize 11 out of the 20 amino acids and bacteria can synthesize all 20. Plus bacteria can synthesize many of the vitamins that humans cannot, including vitamin C. As far as humans are concerned, we can make carbohydrates and glycogen from glucose. We use some amino acids to make nucleic acids and we can synthesize lipids and cholesterol from acetyl coA. There are certain types of fatty acids we can't synthesize and we must get them from our diet.</span>