1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scZoUnD [109]
3 years ago
14

What is one of the most commonly used groups of preservatives in the cosmetic, pharmaceutical, and food industries?

Biology
1 answer:
DiKsa [7]3 years ago
4 0
It would be an antioxidant, and the most commonly used antioxidant would be absorbic acid.<span />
You might be interested in
Coaches will often urge athletes to exercise when they have a cold or other infection. What is the immunological reasoning behin
damaskus [11]

Exercise is the primary advice the coaches give to the athletes if they get a cold or any other infection. The main reason behind this advice is the fact that exercising strengthens the immunity of a person. When a person has an infection, the strengthening of the immune system will help his body to efficiently fight against the infectious pathogens. The blood circulation is increased which is involved in the enhancement of the acute immunity of the person.

3 0
3 years ago
Which question is a nonscientific question?
Sergio [31]
For your first question i think why are roses the best flowers

For your second question it is defeinitley what causes people to be clolor-blind
6 0
2 years ago
A commonly prescribed benzodiazepine for sleep, which is also used to sedate patients receiving dental implants is valium halcio
balu736 [363]
<span>The answer to this is Halcion which is medical treatment given to patients with sleeping disorders such as insomnia. It helps you fall asleep faster and for a longer period of time.</span>
6 0
3 years ago
Please HELP SCIENCE 10 POINTS-
disa [49]
"D" conserve resources.

The 3 R's were made to help people use and conserve resources wisely.

I hope this helps!
~kaikers
5 0
3 years ago
Read 2 more answers
What are 3 example for:
yulyashka [42]

Examples of positive and beneficial mutation:

  • Antibiotic resistance by bacteria
  • Almond tree gene mutation
  • Humans immunity to HIV

Examples of negative and harmful mutation

  • Cystic fibrosis
  • Frame shift mutation
  • Cancer

Examples of neutral mutation;

  • Bovine and human insulin
  • Silent point mutation
  • Missense mutation

<h3>What are mutation?</h3>

Mutations are results from change in gene structures that leads to variations in form that can be transferred or passed down to generations. This is usually caused by alterations in the single base unit of DNAs by insertion, deletion or rearrangement of genes or chromosomes.

Positive and beneficial mutations result in retained from of adaptation like antibiotic resistance by bacteria, harmful mutation causes harm such as cancer, while neutral has little or no effect example, silent mutations.

Learn more on mutations here: brainly.com/question/17031191

#SPJ1

5 0
1 year ago
Other questions:
  • What was the possible function of the horns of the dinocephalian, and was this animal a herbivore or carnivore? question 4 optio
    7·1 answer
  • In many ways, a mule is a superior animal to the horse or donkey. Mules are often stronger and can jump higher than either of th
    5·1 answer
  • Damages Before buying a house, Dean and Donna Testa hired Ground Systems, Inc. (GSI), to inspect and describe the sewage and wat
    13·1 answer
  • In humans, slow fibers are not found in the muscles of the
    5·1 answer
  • What is the difference between a monohybrid cross and a dihybrid cross?
    11·1 answer
  • What is the answer guys??
    8·2 answers
  • In a certain population of rabbits, the allele for brown fur is dominant over the allele for white fur. If 60 out of 100 rabbits
    8·1 answer
  • HELP WILL GIVE BRANLIEST! Please give an explanation
    10·1 answer
  • Can someone help me with this, please? <br><br> What are the eight major mineral groups?
    8·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!