1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreev551 [17]
3 years ago
9

O points

Biology
1 answer:
Anuta_ua [19.1K]3 years ago
4 0

Answer:

.40+900=900.40+300=1200.40

Explanation:

please mark brainliest

You might be interested in
Chlorenchyma and aerenchyma are modified ____________ (a) phloem (b) sclerenchyma (c) collenchyma (d) parenchyma
Alexxandr [17]

They are D) modified parenchyma

6 0
3 years ago
A(n) _____ in a molecule influences the way that a molecule reacts.
vitfil [10]

The correct answer is option B, that is, functional group.  

A functional group refers to a part of a molecule, which is a classified/recognizable group of bound atoms. The functional group provides the molecule with its characteristics, in spite of what molecule comprises it, they are the centers of chemical reactivity. The functional groups in a molecule require to be determined when naming.  


3 0
3 years ago
Read 2 more answers
In physics a players natural resistance to an unbalanced force is called?
ss7ja [257]

Answer:

if a players natural resistance to an unbalanced force is called unbalanced force

5 0
4 years ago
How can a scientist predict how explosive the eruption of a volcano will likely be?
ankoles [38]
By studying the composition of its volcanic rock
3 0
3 years ago
Read 2 more answers
3. Human skin cells divide at a higher rate than neurons (nerve cells). Hypothesize why this may be.
Katena32 [7]

Answer:

the skin cells prevent germs from coming in our bodies

Explanation:

8 0
3 years ago
Other questions:
  • . Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assum
    11·1 answer
  • Early in the development of an embryo, its cells have the potential to become any cell type in the body. What term describes the
    14·1 answer
  • People who have AIDS are more likely than others to become ill with multiple infections because the pathogen that cause AIDS
    8·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Overall, membranes seem to have a great deal in common, but on closer inspection it is revealed that membranes of different cell
    10·1 answer
  • Cells have different membrane carbohydrates if they do different ______.
    11·1 answer
  • Joe walks from his house to the movies 6 miles away. It takes him 2 hours. What is his speed
    6·1 answer
  • I need help with this ASAP
    8·1 answer
  • Choose claim a or b and explain based on your new found understanding
    15·1 answer
  • Identify the term that best describes the process of collecting a tissue sample from the endocervix and the exocervix with a sam
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!