1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stels [109]
3 years ago
15

Henry was studying two populations of the same species of lizards. One population lived on an island and the other lived on the

mainland. Both populations were affected by a hurricane that hit the island and the mainland with equal force. A year later, Henry was testing the gene frequency and saw a decrease in genetic variation in the island species, but not in the mainland species. Which best describes a conclusion he might have reached? Gene flow greatly affects small populations, but large populations can recover. Genetic drift greatly affects small populations, but large populations can recover. Gene flow greatly affects large populations, but small populations can recover. Genetic drift greatly affects large populations, but small populations can recover.
Biology
1 answer:
Llana [10]3 years ago
8 0

the island is a small specie of lizards so if the mainland specie was a large population it would have been the one to be affected by an increase instead of a decrease. The genetic drift was caused by not having enough of the same kind to keep the heredity going, most likely the largest population is the one that had enough of the same heredity to keep the population of lizards going. In a way the hurricane with the force on both species caused a genetic drift but increased a larger population for a year later.

You might be interested in
hypothesize a mechanism to explain how tissues respond to insulin in different ways, even tisses that have the same amount of re
soldi70 [24.7K]
<span>The major effects of insulin on muscle and adipose tissue are: (1) Carbohydrate metabolism: (a) it increases the rate of glucose transport across the cell membrane, (b) it increases the rate of glycolysis by increasing hexokinase and 6-phosphofructokinase activity, (c) it stimulates the rate of glycogen synthesis and decreases the rate of glycogen breakdown. (2) Lipid metabolism: (a) it decreases the rate of lipolysis in adipose tissue and hence lowers the plasma fatty acid level, (b) it stimulates fatty acid and triacylglycerol synthesis in tissues, (c) it increases the uptake of triglycerides from the blood into adipose tissue and muscle, (d) it decreases the rate of fatty acid oxidation in muscle and liver. (3) Protein metabolism: (a) it increases the rate of transport of some amino acids into tissues, (b) it increases the rate of protein synthesis in muscle, adipose tissue, liver, and other tissues, (c) it decreases the rate of protein degradation in muscle (and perhaps other tissues). These insulin effects serve to encourage the synthesis of carbohydrate, fat and protein, therefore, insulin can be considered to be an anabolic hormone.

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!

</span>
4 0
4 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Name 3 characteristics of each physical state of matter.
Andreas93 [3]

Answer:

solid: Has a definite shape and volume. liquid: Has a definite volume, but take the shape of the container. gas: Has no definite shape or volume. change of state: When matter is converted from one of the three states (example: solid, liquid, or gas) to another state.

Explanation:

5 0
3 years ago
Read 2 more answers
The aorta receives the full force of blood exiting the heart during ventricular systole. Describes the adaptive anatomy of the a
11111nata11111 [884]
<h2>Anatomy of Aorta</h2>

Explanation:

  • The protein elastin is found in connective tissues all through the body. It is eminently found in the extracellular lattice of the skin just as the inward organs of the body. The name elastin sounds a lot of like 'flexible.' This is no fortuitous event. The elastin protein is adaptable and gives numerous tissues their versatility.
  • Inferable from its exceptional capacity to extend and withdraw, the aorta additionally fills in as a store that changes the profoundly compelled and pulsatile heart yield into a progression of moderate variances.
  • The tunica intima comprises of a solitary layer of ECs that lines the lumen of the vein and is moored to the fundamental cellar film, an exceptionally particular ECM organize comprising basically of laminin, collagen type IV, fibronectin, perlecan, and heparan sulfate proteoglycans.
  • This storm cellar layer additionally assumes a vital job in flagging occasions that direct EC movement, intrusion, expansion, and survival. The cellar film together with the inward flexible lamina (IEL) fills in as an interface between the tunica intima and tunica media.

4 0
4 years ago
Which of the following is an excitatory neurotransmitter secreted by motor neurons innervating skeletal muscle?
MA_775_DIABLO [31]

Answer:

C) acetylcholine

Explanation:

Acetylcholine is an excitatory neurotransmitter secreted by motor neurons innervating skeletal muscle.

However, norepinephrine, gamma aminobutyric acid, and cholinesterase are not excitatory neurotransmitter secreted by motor neurons innervating skeletal muscle.

6 0
3 years ago
Other questions:
  • Which of the following human activities do not require water?
    15·2 answers
  • How do sulfonamides treat bacterial infections without harming human cells?
    14·1 answer
  • A group of biology students tests the growth of bacteria under different conditions. The students apply the same amount of bacte
    8·2 answers
  • What is meant by predation?
    5·2 answers
  • Carbohydrates contain __________ that your body absolutely must have to stay alive. chemicals
    12·2 answers
  • Which of the following explains why meiosis contributes to genetic variations?
    11·1 answer
  • Describe the most significant restriction on access to potable water around the world.
    5·1 answer
  • Will give brainliest answer !
    10·2 answers
  • If one half of the DNA ladder is above sequence, what is the other side of the ladder’s DNA sequence?
    5·1 answer
  • What is the difference between antibody immunity and cellular immunity?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!